si:ch211-263p13.4

Ensembl ID:
ENSDARG00000056603
ZFIN ID:
ZDB-GENE-091118-4
Human Orthologue:
MCF2
Human Description:
MCF.2 cell line derived transforming sequence [Source:HGNC Symbol;Acc:6940]
Mouse Orthologue:
Mcf2
Mouse Description:
mcf.2 transforming sequence Gene [Source:MGI Symbol;Acc:MGI:96932]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34921 Nonsense Mutation detected in F1 DNA During 2017
sa34920 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21751 Essential Splice Site Available for shipment Available now
sa21750 Nonsense Available for shipment Available now
sa2543 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa34921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089389 Nonsense 78 994 2 27
ENSDART00000141955 Nonsense 95 798 3 20
ENSDART00000146666   None 104 None 4
Genomic Location (Zv9):
Chromosome 10 (position 27426447)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26829241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGTTTGGTGGGAGTCTGGAGCAATGCCACAGTGACTGGATTGTCCTA[C/T]GAACCGTAAAGCAGCATATTGTTTTCATGCAGGAAAAAATTAACAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089389 Essential Splice Site 171 994 4 27
ENSDART00000141955 Essential Splice Site 188 798 5 20
ENSDART00000146666   None 104 None 4
Genomic Location (Zv9):
Chromosome 10 (position 27424011)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26826805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCAGCAGAAGACAGAGACATCAGCCAAGACAAAGAAAGAGTGCAGAG[G/A]TACTGTACACTCAGCAATACTCAATAAAACATCAGCTCTTTTAGGTTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21751
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089389 Essential Splice Site 600 994 15 27
ENSDART00000141955 Essential Splice Site 594 798 15 20
ENSDART00000146666   None 104 None 4
Genomic Location (Zv9):
Chromosome 10 (position 27413025)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26815819
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGCTCAGATGCCCTCTGGAGGCAGTGTTCAGATTCAGCCTTCATCCAG[G/A]TATTACAGTGTGTATTTTTGTTTTTATCACACAATAACAGCTGATTGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089389 Nonsense 708 994 18 27
ENSDART00000141955 Nonsense 702 798 18 20
ENSDART00000146666   None 104 None 4
Genomic Location (Zv9):
Chromosome 10 (position 27410174)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26812968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCAACCACAAGAAAGGCCCAACACGCATGAAGGACATGGCACGCTTT[A/T]AACCAATGCAAAGGCACCTGTTTCTTCATGAAAGAGCTCTGCTTTTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2543
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089389 Essential Splice Site 778 994 19 27
ENSDART00000141955 Essential Splice Site 772 798 19 20
ENSDART00000146666   None 104 None 4
Genomic Location (Zv9):
Chromosome 10 (position 27408021)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26810815
KASP Assay ID:
554-2440.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGTTTGAGATTTGGTACAATGGAAAAGAGGAGGTGTATGTTGTTCAG[G/A]TGAGTCATTTTAGCAAGGTTAAACCTCCACAGAGTGCAATGCATGAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link