plekha3

Ensembl ID:
ENSDARG00000056601
ZFIN ID:
ZDB-GENE-040426-1252
Description:
pleckstrin homology domain-containing family A member 3 [Source:RefSeq peptide;Acc:NP_957501]
Human Orthologues:
AC005795.1, PLEKHA3
Human Descriptions:
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 [Source
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9J6N1]
Mouse Orthologue:
Plekha3
Mouse Description:
pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3 Gene [S

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13861 Nonsense Available for shipment Available now
sa35108 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13861
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079117 Nonsense 33 298 2 8

The following transcripts of ENSDARG00000056601 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 30641450)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29517436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCAAGGTGGTTTGTGCTGGACAATGGCATTATTTCCTATTATGAYTCA[C/T]AAGATGACGTGTGCAAAGGAAGCAAAGGCAGTATTAAGATGTCAGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35108
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079117 Nonsense 173 298 5 8

The following transcripts of ENSDARG00000056601 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 30638902)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29514888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTACTAAGTGCCACCTGTGAAACCTTCATCAAAACACTGGAAGAATG[T/A]ATGAAGATCGCCAACTCTAAGTTCAAGACTGACATGTTGCAGTCCAGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link