LOC557191

Ensembl ID:
ENSDARG00000056591
Mouse Orthologue:
Gucy1b2
Mouse Description:
guanylate cyclase 1, soluble, beta 2 Gene [Source:MGI Symbol;Acc:MGI:2660873]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13072 Nonsense Available for shipment Available now
sa9645 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13072
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079062 Nonsense 28 680 1 12
Genomic Location:
Chromosome 11 (position 30619459)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGAAATCTGGTGGAATTCATCGAAAATCTTGATRCTCTGCACAGCTW[T/A]TTGGCATTGTCTTATGAGGTGAGAATACTTGYACAAAATTGTATATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079062 Nonsense 298 680 7 12
Genomic Location:
Chromosome 11 (position 30625955)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGATGGAGTCGCTGAACTGCATGATCTATCTGTGCTCTCCAAAGCTA[C/T]GAAGTCTCCAGGAGCTAGAGGAACGGGGWCTTCATCTGGCTGACATCGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w17bsvef