LOC557191

Ensembl ID:
ENSDARG00000056591
Mouse Orthologue:
Gucy1b2
Mouse Description:
guanylate cyclase 1, soluble, beta 2 Gene [Source:MGI Symbol;Acc:MGI:2660873]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13072 Nonsense Available for shipment Available now
sa9645 Nonsense Available for shipment Available now
sa27801 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa13072
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079062 Nonsense 28 680 1 12
Genomic Location:
Chromosome 11 (position 30619459)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGAAATCTGGTGGAATTCATCGAAAATCTTGATRCTCTGCACAGCTW[T/A]TTGGCATTGTCTTATGAGGTGAGAATACTTGYACAAAATTGTATATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079062 Nonsense 298 680 7 12
Genomic Location:
Chromosome 11 (position 30625955)
KASP Assay ID:
2260-4420.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGATGGAGTCGCTGAACTGCATGATCTATCTGTGCTCTCCAAAGCTA[C/T]GAAGTCTCCAGGAGCTAGAGGAACGGGGWCTTCATCTGGCTGACATCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27801
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079062 Essential Splice Site 599 680 11 12
Genomic Location:
Chromosome 11 (position 30628920)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGTGTGTACCAGGAAGACCTGGAGGAGGAGACGGATGACCTGAAGGG[T/A]GAGGAAACTCTGTCCATGTCAAAACACATCCAAATATAATTTTTTCAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w17bsvef