A9JRH5_DANRE

Ensembl ID:
ENSDARG00000056587
Description:
LOC563369 protein [Source:UniProtKB/TrEMBL;Acc:A9JRH5]
Human Orthologue:
CYP2R1
Human Description:
cytochrome P450, family 2, subfamily R, polypeptide 1 [Source:HGNC Symbol;Acc:20580]
Mouse Orthologue:
Cyp2r1
Mouse Description:
cytochrome P450, family 2, subfamily r, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:2449771]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7595 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7595
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079091 Missense 411 488 4 5
Genomic Location:
Chromosome 7 (position 28821988)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGAGAAGTACTGGAGCGACCCGTCAATCTTCTGCCCAGAGCGCTTTC[T/C]AGACTGCAATGGCAAATTCATCCGACATGAAGCGTTTCTCCCCTTCTCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l5j655ay