necab1

Ensembl ID:
ENSDARG00000056566
ZFIN ID:
ZDB-GENE-050417-395
Description:
N-terminal EF-hand calcium-binding protein 1 [Source:RefSeq peptide;Acc:NP_001017848]
Human Orthologue:
NECAB1
Human Description:
N-terminal EF-hand calcium binding protein 1 [Source:HGNC Symbol;Acc:20983]
Mouse Orthologue:
Necab1
Mouse Description:
N-terminal EF-hand calcium binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1916602]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13559 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13559
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035049 Essential Splice Site 202 348 None 13
ENSDART00000114117 Essential Splice Site 203 349 None 13
Genomic Location (Zv9):
Chromosome 19 (position 32704167)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31871456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGCAATATGAAAGTGAAAAAAAGGTGAGASAACTGTWTTTCTTTCTGC[A/T]GGTCTGTATGAAGAAGACAACCAGTGGATAACACAGGTCAACAGGCTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link