ppargc1b

Ensembl ID:
ENSDARG00000056563
ZFIN ID:
ZDB-GENE-030616-43
Description:
Novel protein similar to human PGC-1-related estrogen receptor alpha coactivator (PERC) [Source:UniP
Human Orthologue:
PPARGC1B
Human Description:
peroxisome proliferator-activated receptor gamma, coactivator 1 beta [Source:HGNC Symbol;Acc:30022]
Mouse Orthologue:
Ppargc1b
Mouse Description:
peroxisome proliferative activated receptor, gamma, coactivator 1 beta Gene [Source:MGI Symbol;Acc:M

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22475 Nonsense Available for shipment Available now
sa22476 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079080   None 340 None 6
ENSDART00000108942 Nonsense 300 848 5 12
ENSDART00000134058   None 168 None 3
Genomic Location (Zv9):
Chromosome 14 (position 26063246)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24687945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTCGAGCTCATCAAATACATGCACACGTACTGCCTGCCTGTACGCAAA[C/T]AGGCTAGCTGGGATCGCAAAGAACGCGAGGCATTAGCACGGAAAGCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22476
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079080   None 340 None 6
ENSDART00000108942 Nonsense 377 848 5 12
ENSDART00000134058   None 168 None 3
Genomic Location (Zv9):
Chromosome 14 (position 26063479)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24688178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGCTCGTTTGATGTTAGTAAGCCTTATAGGATGCACAGCCCTCCTTA[T/A]ATTCACAGCAGAGGAGCTGCCATTCGGCCCGCTGTTGACGTTTCTTCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Tanning: Genome-wide association study of tanning phenotype in a population of European ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link