asb11

Ensembl ID:
ENSDARG00000056561
ZFIN ID:
ZDB-GENE-070112-532
Description:
ankyrin repeat and SOCS box-containing 11 [Source:RefSeq peptide;Acc:NP_999957]
Human Orthologue:
ASB11
Human Description:
ankyrin repeat and SOCS box-containing 11 [Source:HGNC Symbol;Acc:17186]
Mouse Orthologue:
Asb11
Mouse Description:
ankyrin repeat and SOCS box-containing 11 Gene [Source:MGI Symbol;Acc:MGI:1916104]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu2544 Nonsense Confirmed mutation in F2 line Unknown
sa14489 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu2544
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079068 Nonsense 282 293 7 7
ENSDART00000122813 Nonsense 302 313 8 8
Genomic Location:
Chromosome 9 (position 31398501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGACGCTCACTGGGACAAAAAGGACTCAACAAAACCAAGACCCTTTGCT[T/A]ACCACATATGCTACACAATTATCTTCTCTATCATTAAGACGCGTATAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079068 Nonsense 289 293 7 7
ENSDART00000122813 Nonsense 309 313 8 8
Genomic Location:
Chromosome 9 (position 31398479)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACWCAACAAAACCAAGACCCTTTGCTTACCACATATGCTRCACAATTA[T/A]CTTCYCTATCATTAAGAYRCGTATAAACATTGTCAAGTGTCAMAAMACGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nzyo087f