copb1

Ensembl ID:
ENSDARG00000056557
ZFIN ID:
ZDB-GENE-030219-38
Description:
coatomer subunit beta [Source:RefSeq peptide;Acc:NP_001002013]
Human Orthologue:
COPB1
Human Description:
coatomer protein complex, subunit beta 1 [Source:HGNC Symbol;Acc:2231]
Mouse Orthologue:
Copb1
Mouse Description:
coatomer protein complex, subunit beta 1 Gene [Source:MGI Symbol;Acc:MGI:1917599]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20952 Nonsense Mutation detected in F1 DNA During 2014
sa5418 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3636 Nonsense Mutation detected in F1 DNA During 2014
sa3635 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079042 Nonsense 342 953 9 22
Genomic Location:
Chromosome 7 (position 28933824)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGAGGGTTTTGACCACTCCTGACCTCGAGGTCCGCAAGAAGACTTTA[C/T]AGTTGGCGTTGGACCTGGTGTCATCCCGCAATGTGGAGGAGGTGTGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079042 Essential Splice Site 579 953 14 22
Genomic Location:
Chromosome 7 (position 28939657)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGCCCTGCGCTATGTTGCCCTCGCAGAAGACAAAAGAAGACAAAATG[T/C]AAGTTTGCATGTTTATCACTGCTCCTCTGATGAACTCTGGGTCAACATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3636
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079042 Nonsense 737 953 17 22
Genomic Location:
Chromosome 7 (position 28942521)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTTCTCAGATCCAGTGTATGCAGAAGCTTATGTCCATGTCAATCAGTA[T/G]GACATAGTTTTGGAYGTCTTGGTTGTTAATCAGACTAGCGACACCCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079042 Nonsense 846 953 19 22
Genomic Location:
Chromosome 7 (position 28943179)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTCAACCGGCCTCCTGCACAGACGCCGAGTTCAGACAGATGTGGGCT[G/T]AGTTTGAGTGGGAAAATAAGGCAAGTCTGGAGGACCGGTGGATTCTTAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pa1vwcgm