copb1

Ensembl ID:
ENSDARG00000056557
ZFIN ID:
ZDB-GENE-030219-38
Description:
coatomer subunit beta [Source:RefSeq peptide;Acc:NP_001002013]
Human Orthologue:
COPB1
Human Description:
coatomer protein complex, subunit beta 1 [Source:HGNC Symbol;Acc:2231]
Mouse Orthologue:
Copb1
Mouse Description:
coatomer protein complex, subunit beta 1 Gene [Source:MGI Symbol;Acc:MGI:1917599]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34079 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34080 Nonsense Mutation detected in F1 DNA During 2016
sa20952 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079042 Essential Splice Site 107 953 3 22
Genomic Location (Zv9):
Chromosome 7 (position 28931196)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 27534135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCAAACTTCTTCAGGAGATGATCTTGGTCTGTGATGCCTACAGGAAGG[T/C]GAGTATGAAACATGGACCTTTTATGTCTATTGCTTTATTGTGATAGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079042 Nonsense 341 953 9 22
Genomic Location (Zv9):
Chromosome 7 (position 28933822)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 27536761
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTTGAGGGTTTTGACCACTCCTGACCTCGAGGTCCGCAAGAAGACTT[T/A]ACAGTTGGCGTTGGACCTGGTGTCATCCCGCAATGTGGAGGAGGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079042 Nonsense 342 953 9 22
Genomic Location (Zv9):
Chromosome 7 (position 28933824)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 27536763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGAGGGTTTTGACCACTCCTGACCTCGAGGTCCGCAAGAAGACTTTA[C/T]AGTTGGCGTTGGACCTGGTGTCATCCCGCAATGTGGAGGAGGTGTGTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link