nr0b1

Ensembl ID:
ENSDARG00000056541
ZFIN ID:
ZDB-GENE-070130-1
Description:
nuclear receptor subfamily 0 group B member 1 [Source:RefSeq peptide;Acc:NP_001076416]
Human Orthologue:
NR0B1
Human Description:
nuclear receptor subfamily 0, group B, member 1 [Source:HGNC Symbol;Acc:7960]
Mouse Orthologue:
Nr0b1
Mouse Description:
nuclear receptor subfamily 0, group B, member 1 Gene [Source:MGI Symbol;Acc:MGI:1352460]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41861 Nonsense Mutation detected in F1 DNA During 2017
sa30950 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41861
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079060 Nonsense 263 264 2 2
ENSDART00000128468 Nonsense 291 292 2 2
ENSDART00000079060 Nonsense 263 264 2 2
ENSDART00000128468 Nonsense 291 292 2 2
Genomic Location (Zv9):
Chromosome 11 (position 30560307)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29436293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCATTGGCGCGGTCAACATGGAGGAACTTCTTCTGGAGATGTTTTAT[G/T]GAAAATAAACTTTGAAAAAAACTGGGAGAGAATTATCAGACTTGGAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30950
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079060 Nonsense 263 264 2 2
ENSDART00000128468 Nonsense 291 292 2 2
ENSDART00000079060 Nonsense 263 264 2 2
ENSDART00000128468 Nonsense 291 292 2 2
Genomic Location (Zv9):
Chromosome 11 (position 30560307)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29436293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCATTGGCGCGGTCAACATGGAGGAACTTCTTCTGGAGATGTTTTAT[G/T]GAAAATAAACTTTGAAAAAAACTGGGAGAGAATTATCAGACTTGGAAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link