ENSDARG00000056535

Ensembl ID:
ENSDARG00000056535
Human Orthologues:
JMJD7-PLA2G4B, PLA2G4B, PLA2G4D, PLA2G4E, PLA2G4F
Human Descriptions:
JMJD7-PLA2G4B readthrough [Source:HGNC Symbol;Acc:34449]
phospholipase A2, group IVB (cytosolic) [Source:HGNC Symbol;Acc:9036]
phospholipase A2, group IVD (cytosolic) [Source:HGNC Symbol;Acc:30038]
phospholipase A2, group IVE [Source:HGNC Symbol;Acc:24791]
phospholipase A2, group IVF [Source:HGNC Symbol;Acc:27396]
Mouse Orthologues:
Pla2g4b, Pla2g4d, Pla2g4e, Pla2g4f
Mouse Descriptions:
phospholipase A2, group IVB (cytosolic) Gene [Source:MGI Symbol;Acc:MGI:2384819]
phospholipase A2, group IVD Gene [Source:MGI Symbol;Acc:MGI:1925640]
phospholipase A2, group IVE Gene [Source:MGI Symbol;Acc:MGI:1919144]
phospholipase A2, group IVF Gene [Source:MGI Symbol;Acc:MGI:2685493]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23053 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6469 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079030 Essential Splice Site 165 837 7 20
Genomic Location (Zv9):
Chromosome 17 (position 21285193)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21435342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGTGAGCTGAACGTGGAGATAGACAAGCTTCTTAAGAACTCTGAAGG[T/A]AAATATGTTTTCATTACAAAACATTTTCATCCTAGTTTTTCAAGTAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6469
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079030 Nonsense 833 837 20 20
Genomic Location (Zv9):
Chromosome 17 (position 21296852)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21447001
KASP Assay ID:
554-5397.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGAAAGACCTGTTCAGCACCAACACCACAACCAGGATCACAGAAAACA[C/T]AAAAGACRCAAAAGTAATCTGAATGCAAAACTTGATTMATCTTRAATTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link