ENSDARG00000056535

Ensembl ID:
ENSDARG00000056535
Human Orthologues:
JMJD7-PLA2G4B, PLA2G4B, PLA2G4D, PLA2G4E, PLA2G4F
Human Descriptions:
JMJD7-PLA2G4B readthrough [Source:HGNC Symbol;Acc:34449]
phospholipase A2, group IVB (cytosolic) [Source:HGNC Symbol;Acc:9036]
phospholipase A2, group IVD (cytosolic) [Source:HGNC Symbol;Acc:30038]
phospholipase A2, group IVE [Source:HGNC Symbol;Acc:24791]
phospholipase A2, group IVF [Source:HGNC Symbol;Acc:27396]
Mouse Orthologues:
Pla2g4b, Pla2g4d, Pla2g4e, Pla2g4f
Mouse Descriptions:
phospholipase A2, group IVB (cytosolic) Gene [Source:MGI Symbol;Acc:MGI:2384819]
phospholipase A2, group IVD Gene [Source:MGI Symbol;Acc:MGI:1925640]
phospholipase A2, group IVE Gene [Source:MGI Symbol;Acc:MGI:1919144]
phospholipase A2, group IVF Gene [Source:MGI Symbol;Acc:MGI:2685493]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23053 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19170 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4709 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6469 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079030 Essential Splice Site 165 837 7 20
Genomic Location:
Chromosome 17 (position 21285193)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGTGAGCTGAACGTGGAGATAGACAAGCTTCTTAAGAACTCTGAAGG[T/A]AAATATGTTTTCATTACAAAACATTTTCATCCTAGTTTTTCAAGTAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079030 Essential Splice Site 674 837 19 20
ENSDART00000079030 Essential Splice Site 674 837 19 20
Genomic Location:
Chromosome 17 (position 21295059)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTAGGTTTGCTTGAAAACAAACATTTTCATGCTTTCTTGTGCCCAATA[G/T]GTCGTAAAGCAAGCCCAGGAATACTGCACCGATCGAAAGATCCCATTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079030 Essential Splice Site 674 837 19 20
ENSDART00000079030 Essential Splice Site 674 837 19 20
Genomic Location:
Chromosome 17 (position 21295059)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTAGGTTTGCTTGAAAACAAACATTTTCATGCTTKCTTGTGCCCAATA[G/T]GTYGTAAAGCAAGCCCAGGAATACTGCACCGATCGAAAGATCCCATTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6469
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079030 Nonsense 833 837 20 20
Genomic Location:
Chromosome 17 (position 21296852)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGAAAGACCTGTTCAGCACCAACACCACAACCAGGATCACAGAAAACA[C/T]AAAAGACRCAAAAGTAATCTGAATGCAAAACTTGATTMATCTTRAATTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xb1bpwht