nutf2

Ensembl ID:
ENSDARG00000056531
ZFIN ID:
ZDB-GENE-041010-77
Description:
nuclear transport factor 2-like [Source:RefSeq peptide;Acc:NP_001006000]
Human Orthologue:
NUTF2
Human Description:
nuclear transport factor 2 [Source:HGNC Symbol;Acc:13722]
Mouse Orthologues:
Gm10349, Nutf2, Nutf2-ps1
Mouse Descriptions:
nuclear transport factor 2 Gene [Source:MGI Symbol;Acc:MGI:1915301]
nuclear transport factor 2, pseudogene 1 Pseudogene [Source:MGI Symbol;Acc:MGI:108008]
predicted pseudogene 10349 Pseudogene [Source:MGI Symbol;Acc:MGI:3704482]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10443 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10443
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079050 Essential Splice Site 33 127 2 5
ENSDART00000132034 Essential Splice Site 33 126 2 6
Genomic Location (Zv9):
Chromosome 18 (position 21705198)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21935421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAYTATCAACTGTTTGACACAGACAGGACTCAACTTGGATCAATATATG[T/G]AAGTGTTTTTTGCTGTTGTTGTTCAGGAGGATTCTTCTTTGACTAGTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link