arr3l

Ensembl ID:
ENSDARG00000056511
ZFIN ID:
ZDB-GENE-040718-102
Description:
arrestin 3, retinal (X-arrestin), like [Source:RefSeq peptide;Acc:NP_001002405]
Human Orthologue:
ARR3
Human Description:
arrestin 3, retinal (X-arrestin) [Source:HGNC Symbol;Acc:710]
Mouse Orthologue:
Arr3
Mouse Description:
arrestin 3, retinal Gene [Source:MGI Symbol;Acc:MGI:2159617]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38804 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34922 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17404 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38804
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078996 Essential Splice Site 114 357 6 16
ENSDART00000105733 Essential Splice Site 113 356 8 18
ENSDART00000105734 Essential Splice Site 113 372 4 14
Genomic Location:
Chromosome 10 (position 27441063)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTCTCCTGAAGAAAGCTGGAGAGCAGGGCCATCCCTTCACTTTCAAT[G/A]TAAGTCATCTGCCATCATTTTACTTTTCCTTTTAAGTCTTTTTTAATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34922
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078996 Essential Splice Site 258 357 11 16
ENSDART00000105733 Essential Splice Site 257 356 13 18
ENSDART00000105734 Essential Splice Site 257 372 9 14
Genomic Location:
Chromosome 10 (position 27442920)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTACTCAGCTGACAAATACACCAAAAATGTGCTGACTGAAGAGTTCGG[G/A]TGAGTGTTGTTCTATTTGATAGTGATGTTTGTCAGCCATAAAATCCGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17404
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078996 Essential Splice Site 304 357 12 16
ENSDART00000105733 Essential Splice Site 303 356 14 18
ENSDART00000105734 Essential Splice Site 303 372 10 14
Genomic Location:
Chromosome 10 (position 27443139)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACGGCAGGCTTAAAGATGAAGACACCAATCTGGCCTCAACCACTATG[T/C]GAGTGTTTGGTTCTGTTTTAACGGAAMACAAAACTTTTTTTGGAAATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link