arr3l

Ensembl ID:
ENSDARG00000056511
ZFIN ID:
ZDB-GENE-040718-102
Description:
arrestin 3, retinal (X-arrestin), like [Source:RefSeq peptide;Acc:NP_001002405]
Human Orthologue:
ARR3
Human Description:
arrestin 3, retinal (X-arrestin) [Source:HGNC Symbol;Acc:710]
Mouse Orthologue:
Arr3
Mouse Description:
arrestin 3, retinal Gene [Source:MGI Symbol;Acc:MGI:2159617]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17404 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17404
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078996 Essential Splice Site 304 357 12 16
ENSDART00000105733 Essential Splice Site 303 356 14 18
ENSDART00000105734 Essential Splice Site 303 372 10 14
Genomic Location:
Chromosome 10 (position 27443139)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACGGCAGGCTTAAAGATGAAGACACCAATCTGGCCTCAACCACTATG[T/C]GAGTGTTTGGTTCTGTTTTAACGGAAMACAAAACTTTTTTTGGAAATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jiz338ww