pdik1l

Ensembl ID:
ENSDARG00000056509
ZFIN ID:
ZDB-GENE-051113-236
Description:
Serine/threonine-protein kinase pdik1l [Source:UniProtKB/Swiss-Prot;Acc:Q32PP3]
Human Orthologue:
PDIK1L
Human Description:
PDLIM1 interacting kinase 1 like [Source:HGNC Symbol;Acc:18981]
Mouse Orthologue:
Pdik1l
Mouse Description:
PDLIM1 interacting kinase 1 like Gene [Source:MGI Symbol;Acc:MGI:2385213]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17488 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079014 Nonsense 9 341 2 3
Genomic Location (Zv9):
Chromosome 19 (position 14928091)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15591695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCATGGCAGGTGAGGAAGAAGAGGATGGTGAGCAGTCAGGCCAAGTAC[G/T]AGCTGATCCAGGAGGTAGGCCGGGGCAGTTACGGTGTGGTGTATGAGGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link