si:ch73-113g13.2

Ensembl ID:
ENSDARG00000056506
ZFIN ID:
ZDB-GENE-091204-438

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29038 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6519 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079013 Essential Splice Site 122 313 1 2
ENSDART00000145871   56 240 1 1
Genomic Location (Zv9):
Chromosome 18 (position 22493946)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22724169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCTAACGGTCACGTCCATGAGTGTGCACCGCTATCACAATGTCATCAA[G/A]TCAAGGGTTGCTAACAGGATGATTTTGCACAGACTGGAGCGACGACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079013 Nonsense 294 313 2 2
ENSDART00000145871 Nonsense 234 240 1 1
Genomic Location (Zv9):
Chromosome 18 (position 22493412)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22723635
KASP Assay ID:
554-5434.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGYCGTGTTTATGGTGACACAAGCAAGGCTTCGGCTTTGTTTAACTGTTG[T/A]TTGAATCCTTTCCTTTATGCCATTTCTTTAGGAAACCTTGTTAAATGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link