ca6

Ensembl ID:
ENSDARG00000056499
ZFIN ID:
ZDB-GENE-030131-7091
Human Orthologue:
CA6
Human Description:
carbonic anhydrase VI [Source:HGNC Symbol;Acc:1380]
Mouse Orthologue:
Car6
Mouse Description:
carbonic anhydrase 6 Gene [Source:MGI Symbol;Acc:MGI:1333786]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24318 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079007 None 126 538 3 10
ENSDART00000132733 None 126 530 3 9
ENSDART00000139717 None 97 144 2 4
ENSDART00000141127 Nonsense 140 159 3 5
Genomic Location:
Chromosome 23 (position 22941316)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCAAATGCATCTGCACTGGGGAGGCTGGGACTTGGAGGCCAGTGGATC[A/T]GAGCACACAATGGACGGCATTCGCTACATGGCAGAAGTATTTACATAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oe7u3u4b