ikzf5

Ensembl ID:
ENSDARG00000056491
ZFIN ID:
ZDB-GENE-040801-209
Description:
Zinc finger protein Pegasus [Source:UniProtKB/Swiss-Prot;Acc:Q6DBW0]
Human Orthologue:
IKZF5
Human Description:
IKAROS family zinc finger 5 (Pegasus) [Source:HGNC Symbol;Acc:14283]
Mouse Orthologue:
Ikzf5
Mouse Description:
IKAROS family zinc finger 5 Gene [Source:MGI Symbol;Acc:MGI:1914393]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23055 Essential Splice Site Available for shipment Available now
sa389 Nonsense Available for shipment Available now
sa42916 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23055
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079011 Essential Splice Site 103 419 4 4
ENSDART00000125335 Essential Splice Site 103 419 3 3
ENSDART00000136727   None 52 None 3
ENSDART00000141462 Essential Splice Site 103 168 3 3
ENSDART00000143832 Essential Splice Site 103 122 4 4
Genomic Location (Zv9):
Chromosome 17 (position 21650346)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21800495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTTTGTCAGCTTTACTATTTATAAACTCTTCTCCATCTCCTCTTCCA[G/T]GTGAAAAACCACACAGATGCCACCTGTGTCCTTTCGCCTCGGCCTACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa389
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079011 Nonsense 381 419 4 4
ENSDART00000125335 Nonsense 381 419 3 3
ENSDART00000136727   None 52 None 3
ENSDART00000141462   None 168 None 3
ENSDART00000143832   None 122 None 4
Genomic Location (Zv9):
Chromosome 17 (position 21651182)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21801331
KASP Assay ID:
554-0251.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCATCACTGCCCACATTGTCACATATATTTCCCAGATAACATCCTCTA[T/A]ACCATTCACATGGGCTGCCATGGCTATGAGAACCCTTTTCAGTGTAACAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa42916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079011 Nonsense 411 419 4 4
ENSDART00000125335 Nonsense 411 419 3 3
ENSDART00000136727   None 52 None 3
ENSDART00000141462   None 168 None 3
ENSDART00000143832   None 122 None 4
Genomic Location (Zv9):
Chromosome 17 (position 21651272)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21801421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGTAACATATGCGGGCACAGGTGCAGAAACAGTTATGACTTTGCCTG[T/A]CACTTCGCAAGAGGGCAGCACAAATAAGGACACACACTAGGGTTTTACCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link