ikzf5

Ensembl ID:
ENSDARG00000056491
ZFIN ID:
ZDB-GENE-040801-209
Description:
Zinc finger protein Pegasus [Source:UniProtKB/Swiss-Prot;Acc:Q6DBW0]
Human Orthologue:
IKZF5
Human Description:
IKAROS family zinc finger 5 (Pegasus) [Source:HGNC Symbol;Acc:14283]
Mouse Orthologue:
Ikzf5
Mouse Description:
IKAROS family zinc finger 5 Gene [Source:MGI Symbol;Acc:MGI:1914393]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23055 Essential Splice Site Mutation detected in F1 DNA During 2014
sa389 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079011 Essential Splice Site 103 419 4 4
ENSDART00000125335 Essential Splice Site 103 419 3 3
ENSDART00000136727 None None 52 None 3
ENSDART00000141462 Essential Splice Site 103 168 3 3
ENSDART00000143832 Essential Splice Site 103 122 4 4
Genomic Location:
Chromosome 17 (position 21650346)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTTTGTCAGCTTTACTATTTATAAACTCTTCTCCATCTCCTCTTCCA[G/T]GTGAAAAACCACACAGATGCCACCTGTGTCCTTTCGCCTCGGCCTACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa389
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079011 Nonsense 381 419 4 4
ENSDART00000125335 Nonsense 381 419 3 3
ENSDART00000136727 None None 52 None 3
ENSDART00000141462 None None 168 None 3
ENSDART00000143832 None None 122 None 4
Genomic Location:
Chromosome 17 (position 21651182)
KASP Assay ID:
554-0251.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCATCACTGCCCACATTGTCACATATATTTCCCAGATAACATCCTCTA[T/A]ACCATTCACATGGGCTGCCATGGCTATGAGAACCCTTTTCAGTGTAACAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b1btnt2o