cpvl

Ensembl ID:
ENSDARG00000056480
ZFIN ID:
ZDB-GENE-031219-2
Description:
probable serine carboxypeptidase CPVL [Source:RefSeq peptide;Acc:NP_954972]
Human Orthologue:
CPVL
Human Description:
carboxypeptidase, vitellogenic-like [Source:HGNC Symbol;Acc:14399]
Mouse Orthologue:
Cpvl
Mouse Description:
carboxypeptidase, vitellogenic-like Gene [Source:MGI Symbol;Acc:MGI:1918537]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5890 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078984 Nonsense 438 478 12 13

The following transcripts of ENSDARG00000056480 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 22603160)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCCTGGAAGGTTCAGCCCAGCGACACTGAAGTCGCAGGATACGTTCGA[C/T]AAGTCAGAGARTTCTTTCAGGTGAGGGTTTGTATTGCTARATGTTTGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c05648m4