si:ch211-168b3.1

Ensembl ID:
ENSDARG00000056478
ZFIN ID:
ZDB-GENE-081104-34
Description:
Novel protein similar to vertebrate centaurin, beta 2 (CENTB2) [Source:UniProtKB/TrEMBL;Acc:B8JLA1]
Human Orthologue:
ACAP2
Human Description:
ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 [Source:HGNC Symbol;Acc:16469]
Mouse Orthologue:
Acap2
Mouse Description:
ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 Gene [Source:MGI Symbol;Acc:MGI:1925868]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2032 Essential Splice Site Available for shipment Available now
sa39760 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2032
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092525 Essential Splice Site 37 735 2 22
ENSDART00000131688   None 129 None 4
ENSDART00000147831 Essential Splice Site 37 499 2 17
Genomic Location (Zv9):
Chromosome 2 (position 5533190)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5978918
KASP Assay ID:
554-2588.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGATGTGGAGGAAGACTTTGGAGAACTGGAGTCAAAACTTGACAAGG[T/A]ATGATTTTCTCATTGACATACTGGCTTTAAAGTTTGCTTATGTGNNTTTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa39760
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092525 Essential Splice Site 436 735 15 22
ENSDART00000131688   None 129 None 4
ENSDART00000147831 Splice Site None 499 None 17
Genomic Location (Zv9):
Chromosome 2 (position 5553070)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5998798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGGCATAATGAAATTGACATAAATATTGATAATTATTTTTTTTCTTT[T/C]CAGGAGTTTAGGAGTTCACAATTCAAAGGTGCGATCTCTCACACTCGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link