ccdc125

Ensembl ID:
ENSDARG00000056477
ZFIN ID:
ZDB-GENE-060526-104
Description:
Coiled-coil domain-containing protein 125 [Source:UniProtKB/Swiss-Prot;Acc:A2BGP7]
Human Orthologue:
CCDC125
Human Description:
coiled-coil domain containing 125 [Source:HGNC Symbol;Acc:28924]
Mouse Orthologue:
Ccdc125
Mouse Description:
coiled-coil domain containing 125 Gene [Source:MGI Symbol;Acc:MGI:1923291]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26475 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098500 Nonsense 269 465 8 11
ENSDART00000137027 Nonsense 221 417 8 11
Genomic Location (Zv9):
Chromosome 5 (position 27819876)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25575174
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGGGCGAGCCGTGCTCTTGTGCTAGAAGTGCTGCTGCAAGTCGCAAA[C/T]AGGTCCTCCAGCTCAAGCAAGAGGTACTCGTCTCGTATTTGTCAATACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link