trnau1apl

Ensembl ID:
ENSDARG00000056475
ZFIN ID:
ZDB-GENE-040426-2386
Description:
tRNA selenocysteine 1-associated protein 1-like [Source:UniProtKB/Swiss-Prot;Acc:Q4KM14]
Human Orthologues:
C6orf52, TRNAU1AP
Human Descriptions:
chromosome 6 open reading frame 52 [Source:HGNC Symbol;Acc:20881]
tRNA selenocysteine 1 associated protein 1 [Source:HGNC Symbol;Acc:30813]
Mouse Orthologue:
Trnau1ap
Mouse Description:
tRNA selenocysteine 1 associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1919037]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13677 Nonsense Available for shipment Available now
sa3383 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13677
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078975 Nonsense 193 316 7 9
Genomic Location:
Chromosome 2 (position 23552290)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTAATTCAGCAACAAAGCAAGCACTTACCACAACCAGAATAACACYTA[C/A]AACACCAACTATCAGCAGCAGTACTATCAGCAGCCCTACAACAGTTACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078975 Nonsense 287 316 9 9
Genomic Location:
Chromosome 2 (position 23552764)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCAAACCCACAGGTGGATGTGGAAGAGTTAAATAGGCAGTACATGGAG[C/T]GAAGTGAGGAGCTCTATGATTCGCTCATGGAGTGTCACTGGCTGCCAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0plnn4tf