chaf1b

Ensembl ID:
ENSDARG00000056473
ZFIN ID:
ZDB-GENE-040426-1947
Description:
chromatin assembly factor 1 subunit B [Source:RefSeq peptide;Acc:NP_998177]
Human Orthologue:
CHAF1B
Human Description:
chromatin assembly factor 1, subunit B (p60) [Source:HGNC Symbol;Acc:1911]
Mouse Orthologue:
Chaf1b
Mouse Description:
chromatin assembly factor 1, subunit B (p60) Gene [Source:MGI Symbol;Acc:MGI:1314881]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21510 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21510
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078965 Nonsense 64 237 3 10
ENSDART00000079222 Nonsense 64 613 3 14
ENSDART00000122052 Nonsense 64 613 2 13
Genomic Location:
Chromosome 9 (position 31587062)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAGGGCCTGATGGGAAAGCGGTCGTTGAGTTTTTGTCTAACTTGGCA[C/T]GACACACGAAAGCAGTGAATGTAGTGCGTTTCTCACCCACTGCTGAAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7nuuscs3