asb16

Ensembl ID:
ENSDARG00000056468
ZFIN ID:
ZDB-GENE-031031-3
Description:
ankyrin repeat and SOCS box protein 16 [Source:RefSeq peptide;Acc:NP_001035458]
Human Orthologue:
ASB16
Human Description:
ankyrin repeat and SOCS box-containing 16 [Source:HGNC Symbol;Acc:19768]
Mouse Orthologue:
Asb16
Mouse Description:
ankyrin repeat and SOCS box-containing 16 Gene [Source:MGI Symbol;Acc:MGI:2654437]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5194 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078976 Nonsense 193 428 3 6
ENSDART00000137944 Nonsense 230 465 3 6
Genomic Location:
Chromosome 3 (position 19893102)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAACGTGGCCCAGCGGGACTCRTGTCTGACCCCTCTTCACGTGGCCTG[C/A]AGGAGAGGACTGGAGGAGCACGTTGAGCTCTACCTGTCYTATGGTGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fivfgyj0