lhfpl5

Ensembl ID:
ENSDARG00000056458
ZFIN ID:
ZDB-GENE-080220-51
Description:
lipoma HMGIC fusion partner-like 5 [Source:RefSeq peptide;Acc:NP_001103583]
Human Orthologue:
LHFPL5
Human Description:
lipoma HMGIC fusion partner-like 5 [Source:HGNC Symbol;Acc:21253]
Mouse Orthologue:
Lhfpl5
Mouse Description:
lipoma HMGIC fusion partner-like 5 Gene [Source:MGI Symbol;Acc:MGI:1915382]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30639 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078966 Essential Splice Site 134 216 1 3
ENSDART00000147202 Essential Splice Site 139 221 1 2
Genomic Location (Zv9):
Chromosome 8 (position 24736739)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23862557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACGCCGCTAGTGTCTACAAGATCTGCGCTTGGATGCAAACATCTTCAG[G/A]TAGGCCGCTTTTCAGTGAGCCCTGCAAATAAGTATACATGCTGCTTAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link