sf3a3

Ensembl ID:
ENSDARG00000056447
ZFIN ID:
ZDB-GENE-040908-1
Description:
splicing factor 3A subunit 3 [Source:RefSeq peptide;Acc:NP_001004289]
Human Orthologue:
SF3A3
Human Description:
splicing factor 3a, subunit 3, 60kDa [Source:HGNC Symbol;Acc:10767]
Mouse Orthologue:
Sf3a3
Mouse Description:
splicing factor 3a, subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1922312]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12602 Nonsense Available for shipment Available now
sa39239 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43249 Nonsense Mutation detected in F1 DNA During 2017
sa18610 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12602
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078924 Nonsense 138 501 7 19
ENSDART00000141102 Nonsense 56 419 3 14
Genomic Location (Zv9):
Chromosome 19 (position 16735089)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17398693
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATGTGATTATAGACTTKGTGGAGTTCACTGATGAAGAGGGTTATGGG[C/T]GATACCTGGATCTCCATGACTGCTACCTAAAATATATTAATCTAAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078924 Essential Splice Site 156 501 7 19
ENSDART00000141102 Essential Splice Site 74 419 3 14
Genomic Location (Zv9):
Chromosome 19 (position 16735032)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17398636
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATCTCCATGACTGCTACCTAAAATATATTAATCTAAAAGGAGTAGAG[G/A]TACAGCCTGACATCTTTGAATTGATTATCTCTAAAGAAGTAAACCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078924 Nonsense 206 501 9 19
ENSDART00000141102 Nonsense 124 419 5 14
Genomic Location (Zv9):
Chromosome 19 (position 16734462)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17398066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGGAGTACCTGCAGGAATACACAGATCGCGTCAAGCCTTTGCTGGAT[C/T]AGAATGAGCTGTATGGAAAGATTTTGGCAGAGTTTGAGAAGAAGTGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18610
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078924 Essential Splice Site 458 501 17 19
ENSDART00000141102 Essential Splice Site 376 419 13 14
Genomic Location (Zv9):
Chromosome 19 (position 16725593)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17389197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACCCATCTGGATGGTTATTTATATTTAATTNNNNGTTTGTTTCTCTGCAAT[A/C]GTGTGGTCAAAACTGAAGTCACAGAAAGCATTGGAGCGATGGCAGCCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link