her9

Ensembl ID:
ENSDARG00000056438
ZFIN ID:
ZDB-GENE-011213-1
Description:
hairy-related 9 [Source:RefSeq peptide;Acc:NP_571948]
Human Orthologues:
HES1, HES4
Human Descriptions:
hairy and enhancer of split 1, (Drosophila) [Source:HGNC Symbol;Acc:5192]
hairy and enhancer of split 4 (Drosophila) [Source:HGNC Symbol;Acc:24149]
Mouse Orthologue:
Hes1
Mouse Description:
hairy and enhancer of split 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104853]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43978 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43978
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078936 Nonsense 282 291 4 4

The following transcripts of ENSDARG00000056438 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 23694005)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23473312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCGGGCGTTCCACAAGCCGTCAGTCCCGTTGGTGTCAGTGCCGGAGCA[G/T]AAAGCAATGAGCCGGTGTGGAGACCCTGGTAGACTTGCGCATCTCATATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link