auts2

Ensembl ID:
ENSDARG00000056427
ZFIN ID:
ZDB-GENE-030616-571
Description:
Novel protein similar to human autism-related protein 1 (AUTS2) [Source:UniProtKB/TrEMBL;Acc:Q7ZZ40]
Human Orthologue:
AUTS2
Human Description:
autism susceptibility candidate 2 [Source:HGNC Symbol;Acc:14262]
Mouse Orthologue:
Auts2
Mouse Description:
autism susceptibility candidate 2 Gene [Source:MGI Symbol;Acc:MGI:1919847]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21753 Nonsense Mutation detected in F1 DNA During 2014
sa3751 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21753
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078920 Nonsense 77 1019 1 15
ENSDART00000137928 None None 995 None 14
Genomic Location:
Chromosome 10 (position 27832306)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCTTCATCTTCAGCCACCCCCTTCCAGCAGGGGGTTACCTTTGCCCT[C/A]GAGGCCAGCTCAAATCCAGAACCCTTGCCCAGAGCGCACACTAAGGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3751
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078920 Essential Splice Site 403 1019 8 15
ENSDART00000137928 Essential Splice Site 368 995 8 14
Genomic Location:
Chromosome 10 (position 27825938)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCTCTCTCACTCGTGCTCTCTCTTTTTTTTTTTTCCCTCTCCTCTCT[A/G]GCTGACAGATCCGTTCCGGCCGGTTCTCAGGGTAAGACTRCTTTATCAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mkox6jqs