auts2

Ensembl ID:
ENSDARG00000056427
ZFIN ID:
ZDB-GENE-030616-571
Description:
Novel protein similar to human autism-related protein 1 (AUTS2) [Source:UniProtKB/TrEMBL;Acc:Q7ZZ40]
Human Orthologue:
AUTS2
Human Description:
autism susceptibility candidate 2 [Source:HGNC Symbol;Acc:14262]
Mouse Orthologue:
Auts2
Mouse Description:
autism susceptibility candidate 2 Gene [Source:MGI Symbol;Acc:MGI:1919847]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21753 Nonsense Available for shipment Available now
sa45409 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21753
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078920 Nonsense 77 1019 1 15
ENSDART00000137928   None 995 None 14
Genomic Location (Zv9):
Chromosome 10 (position 27832306)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 27235100
GRCz11 10 27196813
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCTTCATCTTCAGCCACCCCCTTCCAGCAGGGGGTTACCTTTGCCCT[C/A]GAGGCCAGCTCAAATCCAGAACCCTTGCCCAGAGCGCACACTAAGGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078920 Essential Splice Site 594 1019 None 15
ENSDART00000137928   570 995 13 14
Genomic Location (Zv9):
Chromosome 10 (position 27821435)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 27224229
GRCz11 10 27185942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCAGTCAGCTCACATGAGAGAGAACGAGAGCGGGACAGAGAGAGAGAG[C/A]GGGACCTGGACAAGAGGGACTCATCAGTCAACAAGGATGATAAAGAACGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link