adipoql

Ensembl ID:
ENSDARG00000056411
ZFIN IDs:
ZDB-GENE-060825-220, ZDB-GENE-060825-220
Description:
adiponectin [Source:RefSeq peptide;Acc:NP_001038890]
Human Orthologue:
ADIPOQ
Human Description:
adiponectin, C1Q and collagen domain containing [Source:HGNC Symbol;Acc:13633]
Mouse Orthologue:
Adipoq
Mouse Description:
adiponectin, C1Q and collagen domain containing Gene [Source:MGI Symbol;Acc:MGI:106675]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14942 Nonsense Available for shipment Available now
sa19656 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14942
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058105 Nonsense 29 275 1 2
ENSDART00000078901 Nonsense 29 275 2 3
Genomic Location:
Chromosome 2 (position 3182907)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGACTGGWCATCTGTGTGGAGGTCAAGACGAACTACTAGAGGACAGTT[T/G]AGAGACAGCAGTGGATGAAGTGGCCACTGAGGGAATCRAGGAGCTGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058105 Nonsense 237 275 2 2
ENSDART00000078901 Nonsense 237 275 3 3
Genomic Location:
Chromosome 2 (position 3179699)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGGACCAGGCGTCAGGCTCTGTGATCTTGCGTTTGGAGGCAGGAGAT[G/T]AAGTGTGGCTGCAGGTCTATGGAGACGAGACGGTTGGAGGAGTGTATGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Adiponectin levels: A genome-wide association study reveals variants in ARL15 that influence adiponectin levels. (View Study)
  • Adiponectin levels: Clear detection of ADIPOQ locus as the major gene for plasma adiponectin: results of genome-wide association analyses including 4659 European individuals. (View Study)
  • Adiponectin levels: Genome-wide association study for adiponectin levels in Filipino women identifies CDH13 and a novel uncommon haplotype at KNG1-ADIPOQ. (View Study)
  • Adiponectin levels: Genome-wide linkage and association analyses to identify genes influencing adiponectin levels: the GEMS Study. (View Study)
  • Adiponectin levels: Novel loci for adiponectin levels and their influence on type 2 diabetes and metabolic traits: a multi-ethnic meta-analysis of 45,891 individuals. (View Study)
  • Adiponectin levels: Novel locus FER is associated with serum HMW adiponectin levels. (View Study)
  • Prothrombin time: Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ixbsu7d8