helt

Ensembl ID:
ENSDARG00000056400
ZFIN ID:
ZDB-GENE-040824-6
Description:
Hairy and enhancer of split-related protein helt [Source:UniProtKB/Swiss-Prot;Acc:Q6QB00]
Human Orthologue:
HELT
Human Description:
HES/HEY-like transcription factor [Source:HGNC Symbol;Acc:33783]
Mouse Orthologue:
Helt
Mouse Description:
Hey-like transcription factor (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:3040955]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38254 Essential Splice Site Mutation detected in F1 DNA During 2016
sa19463 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078889 Essential Splice Site 125 270 3 4
Genomic Location (Zv9):
Chromosome 1 (position 16336317)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16901485
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATCTGCGCGCGCTCCACTCAGCAGACTTTCCGCGCGGGAGAGAAAAAG[G/A]TAGGAATCATGACATAAATCTATGAAGTACAAATCTAAATACGTTCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078889 Nonsense 156 270 4 4
Genomic Location (Zv9):
Chromosome 1 (position 16336501)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16901669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTATCACGAGTGCATGAAAAACCTCGTTCACTACTTAACCACCGTAGAG[C/T]GAATGGAGACCAAAGACACCAAGTACGCGCGGATCCTCGCCTTTCTACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link