helt

Ensembl ID:
ENSDARG00000056400
ZFIN ID:
ZDB-GENE-040824-6
Description:
Hairy and enhancer of split-related protein helt [Source:UniProtKB/Swiss-Prot;Acc:Q6QB00]
Human Orthologue:
HELT
Human Description:
HES/HEY-like transcription factor [Source:HGNC Symbol;Acc:33783]
Mouse Orthologue:
Helt
Mouse Description:
Hey-like transcription factor (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:3040955]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4837 Nonsense Mutation detected in F1 DNA During 2016
sa38254 Essential Splice Site Mutation detected in F1 DNA During 2016
sa19463 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078889 Nonsense 84 270 2 4
Genomic Location:
Chromosome 1 (position 16336108)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGAGAAAAGAAGAAGAGACCGAATCAACAGATGTCTAAACGAACTGGGG[A/T]AGACTGTACCAATGGCATTGGCTAAGCAGGTGCGCATTTGAAACACTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078889 Essential Splice Site 125 270 3 4
Genomic Location:
Chromosome 1 (position 16336317)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATCTGCGCGCGCTCCACTCAGCAGACTTTCCGCGCGGGAGAGAAAAAG[G/A]TAGGAATCATGACATAAATCTATGAAGTACAAATCTAAATACGTTCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078889 Nonsense 156 270 4 4
Genomic Location:
Chromosome 1 (position 16336501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTATCACGAGTGCATGAAAAACCTCGTTCACTACTTAACCACCGTAGAG[C/T]GAATGGAGACCAAAGACACCAAGTACGCGCGGATCCTCGCCTTTCTACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link