helt

Ensembl ID:
ENSDARG00000056400
ZFIN ID:
ZDB-GENE-040824-6
Description:
Hairy and enhancer of split-related protein helt [Source:UniProtKB/Swiss-Prot;Acc:Q6QB00]
Human Orthologue:
HELT
Human Description:
HES/HEY-like transcription factor [Source:HGNC Symbol;Acc:33783]
Mouse Orthologue:
Helt
Mouse Description:
Hey-like transcription factor (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:3040955]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4837 Nonsense Mutation detected in F1 DNA During 2014
sa19463 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078889 Nonsense 84 270 2 4
Genomic Location:
Chromosome 1 (position 16336108)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGAGAAAAGAAGAAGAGACCGAATCAACAGATGTCTAAACGAACTGGGG[A/T]AGACTGTACCAATGGCATTGGCTAAGCAGGTGCGCATTTGAAACACTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078889 Nonsense 156 270 4 4
Genomic Location:
Chromosome 1 (position 16336501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTATCACGAGTGCATGAAAAACCTCGTTCACTACTTAACCACCGTAGAG[C/T]GAATGGAGACCAAAGACACCAAGTACGCGCGGATCCTCGCCTTTCTACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qm44tdmc