dusp22a

Ensembl ID:
ENSDARG00000056396
ZFIN ID:
ZDB-GENE-040718-219
Description:
Dual specificity protein phosphatase 22-A [Source:UniProtKB/Swiss-Prot;Acc:Q1LWL2]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32212 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32212
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078888 Nonsense 189 208 7 7
Genomic Location (Zv9):
Chromosome 18 (position 30508400)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30585868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAGAACAGCAGCAACAAGGACAACAAAATGATCCGGAGTGGATGAGC[C/T]AGGGCTCTCGCATCTATCCTCTGTCCTACAACCAATACAGTGCCTCGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link