onecut3

Ensembl ID:
ENSDARG00000056395
ZFIN ID:
ZDB-GENE-050208-744
Description:
Novel protein similar to vertebrate one cut domain, family [Source:UniProtKB/TrEMBL;Acc:Q1LY59]
Human Orthologue:
ONECUT3
Human Description:
one cut homeobox 3 [Source:HGNC Symbol;Acc:13399]
Mouse Orthologue:
Onecut3
Mouse Description:
one cut domain, family member 3 Gene [Source:MGI Symbol;Acc:MGI:1891409]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7494 Missense Mutation detected in F1 DNA During 2017
sa43821 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7494
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078885 Missense 49 451 1 2
ENSDART00000135984 Missense 52 447 1 2
Genomic Location (Zv9):
Chromosome 22 (position 20781987)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20436663
KASP Assay ID:
554-4095.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGACACATAGGAACTTGGTATCATCGCACGGGAGGTCAGCGATGGTGT[C/T]CAGCATGGCCTCGATACTGGACGGGGCCGGGGAGTATCGCACGGACCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078885 Nonsense 180 451 1 2
ENSDART00000135984 Nonsense 183 447 1 2
Genomic Location (Zv9):
Chromosome 22 (position 20782379)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20437055
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTTTGTCACCTCTTTCCAACGGCCTTGGGTCTTTGCACAACTCTCAA[C/T]AAACTCTAAGTGCGTACGGTCCGAGTGCTCACCTGGGGAATGACAAGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link