TOM1L2 (1 of 2)

Ensembl ID:
ENSDARG00000056394
Description:
target of myb1-like 2 (chicken) [Source:HGNC Symbol;Acc:11984]
Human Orthologue:
TOM1L2
Human Description:
target of myb1-like 2 (chicken) [Source:HGNC Symbol;Acc:11984]
Mouse Orthologue:
Tom1l2
Mouse Description:
target of myb1-like 2 (chicken) Gene [Source:MGI Symbol;Acc:MGI:2443306]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6925 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097345 Essential Splice Site 168 522 5 18
Genomic Location:
Chromosome 3 (position 62779012)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCATGGCGGATCTGGACGCTCTCTCRCCCATACACACACCACAGCGGG[T/C]GAGAGATCGCATACACMAGTCTCATATCACCATATAAGTCATCTCATATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/81e0gyob