ARAP2

Ensembl ID:
ENSDARG00000056389
Description:
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 [Source:HGNC Symbol;Acc:16924]
Human Orthologue:
ARAP2
Human Description:
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 [Source:HGNC Symbol;Acc:16924]
Mouse Orthologue:
Arap2
Mouse Description:
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 Gene [Source:MGI Symbol;Acc:MGI:2684416]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12743 Nonsense Available for shipment Available now
sa17957 Essential Splice Site Available for shipment Available now
sa34218 Nonsense Mutation detected in F1 DNA During 2016
sa9517 Essential Splice Site Available for shipment Available now
sa7098 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41062 Nonsense Mutation detected in F1 DNA During 2016
sa21116 Splice Site, Nonsense Available for shipment Available now
sa41063 Nonsense Mutation detected in F1 DNA During 2016
sa11046 Nonsense Available for shipment Available now
sa34219 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12743
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078816 Nonsense 306 1612 5 32
Genomic Location (Zv9):
Chromosome 7 (position 64318151)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64114685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTCACTCTACTATTTGTTTATTTATTTTTTTCAGACACAWGCAGACA[C/T]AAGCCAAAGAAAAAGTACATTATAACAACAAGCAAGACCTTTCCAAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17957
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078816 Essential Splice Site 430 1612 5 32
Genomic Location (Zv9):
Chromosome 7 (position 64318526)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64114310
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAGACTGCAACYAAAGCCGGCTGGCTGGACAAACTCTCCCCTCAAGGG[T/C]AAAGAATATGYAAAAAGCNNNNNNTCTTTATTTGCAATTTTTTTGCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078816 Nonsense 616 1612 10 32
Genomic Location (Zv9):
Chromosome 7 (position 64377481)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64055355
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGGATCGAGGCTGTTCAGGAGTCCATCGTAGAGACGTTGTGCAATTA[T/G]GAGGTGCTGGAGAAAGTTTGGTTCAACAAGTCCAACAGGAAGTGTGCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078816 Essential Splice Site 928 1612 16 32
Genomic Location (Zv9):
Chromosome 7 (position 64415818)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64017018
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGAGACCTCGGACGCACACCAAGATTGGACAAACGCCATAGCCAAGG[T/G]CACACACATAGACACACACAYACATACATTTGTTTTTGTGAAYTGTGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078816 Essential Splice Site 1275 1612 25 32
Genomic Location (Zv9):
Chromosome 7 (position 64445934)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 63986906
KASP Assay ID:
554-4998.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTCTTGAACTTTCAAAACACTGAATGATGCTGATGTGCGTTTCTTTTA[G/A]ATCTCTCCGAATATGAGGTCAGATGAACTTGCCGTCAGCACTCTGGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078816 Nonsense 1376 1612 27 32
Genomic Location (Zv9):
Chromosome 7 (position 64449578)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 63983262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGGATTTCATTAAAGGAGAGCATCTCAAATTCAAAGACGGTTCTTCC[A/T]AACTGCTATTGGGGAATAAGTTTCAGGACCGCTACTTGGTACTACAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21116
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078816 Splice Site, Nonsense 1442 1612 30 32
Genomic Location (Zv9):
Chromosome 7 (position 64459377)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 63973463
KASP Assay ID:
2259-9692.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTTCACTTGAGTGCTTCAGTGTTCACCTTTGCATCGTCTCTGAAACAG[G/A]TATTTCTGCTGTAAAGGGAATGATTCTCAGCAGGACTGGGTCACCTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078816 Nonsense 1520 1612 32 32
Genomic Location (Zv9):
Chromosome 7 (position 64471119)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 63961721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTTAAAGGAAAGTCGGTGCTTACTACTAGTACAGAAGATTCAAATACA[C/T]AAAACCAAATGGCCGCAGATGAGGGCATCCGACCGGACTCGCTGCATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11046
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078816 Nonsense 1561 1612 32 32
Genomic Location (Zv9):
Chromosome 7 (position 64471242)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 63961598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGTGTCTCCAGGCTTGAAATGGTGATTGATGACACACTCCAGTCCCAA[C/T]GAAGGGCATCACTTCAACAAGACACTGCCACTCTAACCCAGATTTCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078816 Nonsense 1574 1612 32 32
Genomic Location (Zv9):
Chromosome 7 (position 64471281)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 63961559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGTCCCAACGAAGGGCATCACTTCAACAAGACACTGCCACTCTAACC[C/T]AGATTTCACAAAGGAAAGCCGCTATTCCCGGCAGAGGAGTGCAGTTGCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link