ARAP2

Ensembl ID:
ENSDARG00000056389
Description:
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 [Source:HGNC Symbol;Acc:16924]
Human Orthologue:
ARAP2
Human Description:
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 [Source:HGNC Symbol;Acc:16924]
Mouse Orthologue:
Arap2
Mouse Description:
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 Gene [Source:MGI Symbol;Acc:MGI:2684416]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12743 Nonsense Available for shipment Available now
sa17957 Essential Splice Site Available for shipment Available now
sa9517 Essential Splice Site Available for shipment Available now
sa7098 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21116 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa11046 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12743
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078816 Nonsense 306 1612 5 32
Genomic Location:
Chromosome 7 (position 64318151)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTCACTCTACTATTTGTTTATTTATTTTTTTCAGACACAWGCAGACA[C/T]AAGCCAAAGAAAAAGTACATTATAACAACAAGCAAGACCTTTCCAAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17957
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078816 Essential Splice Site 430 1612 5 32
Genomic Location:
Chromosome 7 (position 64318526)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAGACTGCAACYAAAGCCGGCTGGCTGGACAAACTCTCCCCTCAAGGG[T/C]AAAGAATATGYAAAAAGCNNNNNNTCTTTATTTGCAATTTTTTTGCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078816 Essential Splice Site 928 1612 16 32
Genomic Location:
Chromosome 7 (position 64415818)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGAGACCTCGGACGCACACCAAGATTGGACAAACGCCATAGCCAAGG[T/G]CACACACATAGACACACACAYACATACATTTGTTTTTGTGAAYTGTGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078816 Essential Splice Site 1275 1612 25 32
Genomic Location:
Chromosome 7 (position 64445934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTCTTGAACTTTCAAAACACTGAATGATGCTGATGTGCGTTTCTTTTA[G/A]ATCTCTCCGAATATGAGGTCAGATGAACTTGCCGTCAGCACTCTGGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078816 Splice Site, Nonsense 1442 1612 30 32
Genomic Location:
Chromosome 7 (position 64459377)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTTCACTTGAGTGCTTCAGTGTTCACCTTTGCATCGTCTCTGAAACAG[G/A]TATTTCTGCTGTAAAGGGAATGATTCTCAGCAGGACTGGGTCACCTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11046
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078816 Nonsense 1561 1612 32 32
Genomic Location:
Chromosome 7 (position 64471242)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGTGTCTCCAGGCTTGAAATGGTGATTGATGACACACTCCAGTCCCAA[C/T]GAAGGGCATCACTTCAACAAGACACTGCCACTCTAACCCAGATTTCACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z75q8ww2