rnf17

Ensembl ID:
ENSDARG00000056387
ZFIN ID:
ZDB-GENE-030131-6451
Description:
Rnf17 protein [Source:UniProtKB/TrEMBL;Acc:Q58EH8]
Human Orthologue:
RNF17
Human Description:
ring finger protein 17 [Source:HGNC Symbol;Acc:10060]
Mouse Orthologue:
Rnf17
Mouse Description:
ring finger protein 17 Gene [Source:MGI Symbol;Acc:MGI:1353419]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10164 Nonsense Available for shipment Available now
sa7188 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10164
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060225 None None 422 None 12
ENSDART00000123679 None None 500 None 13
ENSDART00000132295 Nonsense 341 1155 8 27
ENSDART00000145659 None None 323 None 10
Genomic Location:
Chromosome 9 (position 30593073)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTTAGTGATTAAAAAAATGTCTTTATATCTCAGGGTTCCCTGGTGGC[C/T]GAATGGTGGAGGTTCGGTTTGTGGACTTYGGCTACAAAAGRACTCTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060225 Nonsense 265 422 8 12
ENSDART00000123679 Nonsense 343 500 10 13
ENSDART00000132295 Nonsense 998 1155 23 27
ENSDART00000145659 None None 323 None 10
Genomic Location:
Chromosome 9 (position 30601785)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGAGTCTGTGCAAACTGGAGCAGGATGAGAGTATGGAGGAAACTCTT[G/T]AACAAGTGAATGAGAATATTGAAAATCTGAGCCTGCTGACAGACTTCCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/atv0h8yc