rnf17

Ensembl ID:
ENSDARG00000056387
ZFIN ID:
ZDB-GENE-030131-6451
Description:
Rnf17 protein [Source:UniProtKB/TrEMBL;Acc:Q58EH8]
Human Orthologue:
RNF17
Human Description:
ring finger protein 17 [Source:HGNC Symbol;Acc:10060]
Mouse Orthologue:
Rnf17
Mouse Description:
ring finger protein 17 Gene [Source:MGI Symbol;Acc:MGI:1353419]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41439 Nonsense Mutation detected in F1 DNA During 2016
sa10164 Nonsense Available for shipment Available now
sa7188 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060225   None 422 None 12
ENSDART00000123679   None 500 None 13
ENSDART00000132295   None 1155 None 27
ENSDART00000145659 Nonsense 81 323 3 10
Genomic Location (Zv9):
Chromosome 9 (position 30584299)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29740245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGAGTTGATGGTTTAGAGGTGGACAGCAGAATCATTGGCCTCATCTA[T/A]ACAGCACGCATGAACACAAAGAAAGGGTAATTACTGTCAAAACTCTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10164
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060225   None 422 None 12
ENSDART00000123679   None 500 None 13
ENSDART00000132295 Nonsense 341 1155 8 27
ENSDART00000145659   None 323 None 10
Genomic Location (Zv9):
Chromosome 9 (position 30593073)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29749019
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTTAGTGATTAAAAAAATGTCTTTATATCTCAGGGTTCCCTGGTGGC[C/T]GAATGGTGGAGGTTCGGTTTGTGGACTTYGGCTACAAAAGRACTCTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060225 Nonsense 265 422 8 12
ENSDART00000123679 Nonsense 343 500 10 13
ENSDART00000132295 Nonsense 998 1155 23 27
ENSDART00000145659   None 323 None 10
Genomic Location (Zv9):
Chromosome 9 (position 30601785)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29757731
KASP Assay ID:
554-5146.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGAGTCTGTGCAAACTGGAGCAGGATGAGAGTATGGAGGAAACTCTT[G/T]AACAAGTGAATGAGAATATTGAAAATCTGAGCCTGCTGACAGACTTCCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link