si:ch211-154o6.6

Ensembl ID:
ENSDARG00000056379
ZFIN ID:
ZDB-GENE-060503-576
Description:
hypothetical protein LOC564061 [Source:RefSeq peptide;Acc:NP_001038504]
Human Orthologues:
CLEC4A, CLEC4C, CLEC4D, CLEC4E, CLEC6A
Human Descriptions:
C-type lectin domain family 4, member A [Source:HGNC Symbol;Acc:13257]
C-type lectin domain family 4, member C [Source:HGNC Symbol;Acc:13258]
C-type lectin domain family 4, member D [Source:HGNC Symbol;Acc:14554]
C-type lectin domain family 4, member E [Source:HGNC Symbol;Acc:14555]
C-type lectin domain family 6, member A [Source:HGNC Symbol;Acc:14556]
Mouse Orthologues:
Clec4a1, Clec4a2, Clec4a3, Clec4a4, Clec4b1, Clec4b2, Clec4d, Clec4e, Clec4n
Mouse Descriptions:
C-type lectin domain family 4, member a1 Gene [Source:MGI Symbol;Acc:MGI:3036291]
C-type lectin domain family 4, member a2 Gene [Source:MGI Symbol;Acc:MGI:1349412]
C-type lectin domain family 4, member a3 Gene [Source:MGI Symbol;Acc:MGI:1920399]
C-type lectin domain family 4, member a4 Gene [Source:MGI Symbol;Acc:MGI:3624119]
C-type lectin domain family 4, member b1 Gene [Source:MGI Symbol;Acc:MGI:1917060]
C-type lectin domain family 4, member b2 Gene [Source:MGI Symbol;Acc:MGI:3588267]
C-type lectin domain family 4, member d Gene [Source:MGI Symbol;Acc:MGI:1298389]
C-type lectin domain family 4, member e Gene [Source:MGI Symbol;Acc:MGI:1861232]
C-type lectin domain family 4, member n Gene [Source:MGI Symbol;Acc:MGI:1861231]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10971 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10971
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078858 Essential Splice Site 33 263 1 6
Genomic Location (Zv9):
Chromosome 16 (position 23969993)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21980731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCTCATTGTGGGAACAGACCTATACTCTCATCACAGAGCAAACAAGG[T/C]AATGTTTGTATGCGTGTGTGTCTGGGAWTGTGAGGATCAAGGGTCAAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link