ifi30

Ensembl ID:
ENSDARG00000056378
ZFIN ID:
ZDB-GENE-030131-8447
Description:
interferon gamma inducible protein 30 [Source:RefSeq peptide;Acc:NP_001006057]
Human Orthologue:
IFI30
Human Description:
interferon, gamma-inducible protein 30 [Source:HGNC Symbol;Acc:5398]
Mouse Orthologue:
Ifi30
Mouse Description:
interferon gamma inducible protein 30 Gene [Source:MGI Symbol;Acc:MGI:2137648]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39829 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17401 Nonsense Available for shipment Available now
sa19758 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39829
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078866 Essential Splice Site 45 255 None 7

The following transcripts of ENSDARG00000056378 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 24532389)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGCCTTCACAATGGTGCAGCTCCGAGGACATAGCAGCTGAATGTGGGG[T/C]AAGAGTGACTCCTGTACCAAAACAAATGTAACTTTAGCAACCTTTTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078866 Nonsense 53 255 2 7

The following transcripts of ENSDARG00000056378 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 24532819)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACTGTTCCCTTTATTCTCATTTAAGGTGCTGGAACAATGCATGAAGTA[T/G]AACTCGACAAAGGCCGCTGACAAGGTGAAAGTGAGCCTCTACTATGAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19758
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078866 Nonsense 72 255 2 7

The following transcripts of ENSDARG00000056378 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 24532876)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAAGGCCGCTGACAAGGTGAAAGTGAGCCTCTACTATGAATCTCTGTG[C/A]CCAGGATGCAGAATGTTTCTTACATCTCAGCTCGTGCCAACCTTGATTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link