ifi30

Ensembl ID:
ENSDARG00000056378
ZFIN ID:
ZDB-GENE-030131-8447
Description:
interferon gamma inducible protein 30 [Source:RefSeq peptide;Acc:NP_001006057]
Human Orthologue:
IFI30
Human Description:
interferon, gamma-inducible protein 30 [Source:HGNC Symbol;Acc:5398]
Mouse Orthologue:
Ifi30
Mouse Description:
interferon gamma inducible protein 30 Gene [Source:MGI Symbol;Acc:MGI:2137648]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17401 Nonsense Available for shipment Available now
sa19758 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078866 Nonsense 53 255 2 7

The following transcripts of ENSDARG00000056378 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 24532819)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACTGTTCCCTTTATTCTCATTTAAGGTGCTGGAACAATGCATGAAGTA[T/G]AACTCGACAAAGGCCGCTGACAAGGTGAAAGTGAGCCTCTACTATGAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19758
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078866 Nonsense 72 255 2 7

The following transcripts of ENSDARG00000056378 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 24532876)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAAGGCCGCTGACAAGGTGAAAGTGAGCCTCTACTATGAATCTCTGTG[C/A]CCAGGATGCAGAATGTTTCTTACATCTCAGCTCGTGCCAACCTTGATTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3z2s76c3