ufsp2

Ensembl ID:
ENSDARG00000056369
ZFIN ID:
ZDB-GENE-030131-8726
Description:
Ufm1-specific protease 2 [Source:UniProtKB/Swiss-Prot;Acc:Q7T347]
Human Orthologue:
UFSP2
Human Description:
UFM1-specific peptidase 2 [Source:HGNC Symbol;Acc:25640]
Mouse Orthologue:
Ufsp2
Mouse Description:
UFM1-specific peptidase 2 Gene [Source:MGI Symbol;Acc:MGI:1913679]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1746 Nonsense Available for shipment Available now
sa4838 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1746
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078848 Nonsense 119 401 5 11
ENSDART00000122670 Nonsense 184 466 6 12
ENSDART00000148322 Nonsense 119 401 7 13

The following transcripts of ENSDARG00000056369 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 16450581)
KASP Assay ID:
554-1739.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGCATTAAATAAGCAGATAGCAGATATGGAGGAGGTGGTCCTCCGGTA[T/G]AGGAAGGGCTCCTCGTTCCTGGTGCCACAGCCATTTCACTTTCAGCTGCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa4838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078848 Nonsense 251 401 7 11
ENSDART00000122670 Nonsense 316 466 8 12
ENSDART00000148322 Nonsense 251 401 9 13

The following transcripts of ENSDARG00000056369 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 16444581)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATATCGTTCCCTTCAGACCATCTGCTCTTGGTTCCAGCAGCAAGGATA[T/A]GTGGAGACAGCTGTTCCCACACACACGCAGATCCAGCAGGTAAGATAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gickmmp6