mpv17l2

Ensembl ID:
ENSDARG00000056367
ZFIN ID:
ZDB-GENE-040718-306
Description:
Mpv17-like protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6DGV7]
Human Orthologues:
AC068499.1, MPV17L2
Human Descriptions:
MPV17 mitochondrial membrane protein-like 2 [Source:HGNC Symbol;Acc:28177]
Mpv17-like protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q567V2]
Mouse Orthologue:
Mpv17l2
Mouse Description:
MPV17 mitochondrial membrane protein-like 2 Gene [Source:MGI Symbol;Acc:MGI:2681846]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39830 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078854 Nonsense 168 199 4 5
Genomic Location (Zv9):
Chromosome 2 (position 24544005)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25118782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCAGATGATAAATTTCTACTTCCTGCCACCCAAGTTTCGTGTCCTTTA[T/A]GTGAATATAGTTACTCTGGGATGGGACACTTACCTCTCCTACCTCAAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link