ahcyl1

Ensembl ID:
ENSDARG00000056331
ZFIN ID:
ZDB-GENE-021206-7
Description:
putative adenosylhomocysteinase 2 [Source:RefSeq peptide;Acc:NP_958450]
Human Orthologue:
AHCYL1
Human Description:
adenosylhomocysteinase-like 1 [Source:HGNC Symbol;Acc:344]
Mouse Orthologue:
Ahcyl1
Mouse Description:
S-adenosylhomocysteine hydrolase-like 1 Gene [Source:MGI Symbol;Acc:MGI:2385184]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5478 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078792 Nonsense 19 500 2 17
ENSDART00000078795 Nonsense 73 554 2 17
Genomic Location:
Chromosome 8 (position 25846905)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCATCCTCTCTTTTTCTTCAGATTCAGTTTGCCAACCAGGAGGACAAA[C/T]AGGAGTTTAGCAAGTTCCCTACAAAAACAGGCCGCCGCTCCCTGTCTCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5hnl4d6q