ldb3a

Ensembl ID:
ENSDARG00000056322
ZFIN ID:
ZDB-GENE-040121-6
Description:
LIM-domain binding factor 3 [Source:RefSeq peptide;Acc:NP_958913]
Human Orthologue:
LDB3
Human Description:
LIM domain binding 3 [Source:HGNC Symbol;Acc:15710]
Mouse Orthologue:
Ldb3
Mouse Description:
LIM domain binding 3 Gene [Source:MGI Symbol;Acc:MGI:1344412]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1447 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa1447
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044719 Essential Splice Site 252 283 7 8
ENSDART00000074061 None None 589 None 13
ENSDART00000074064 None None 501 None 12
ENSDART00000078720 None None 159 None 6
ENSDART00000078721 Essential Splice Site 268 299 6 7
ENSDART00000078740 Essential Splice Site 260 291 9 10
ENSDART00000078747 None None 580 None 12
ENSDART00000078757 None None 596 None 11
ENSDART00000078759 None None 649 None 12
ENSDART00000126467 None None 646 None 14
ENSDART00000129841 None None 350 None 11
ENSDART00000130101 None None 200 None 5
ENSDART00000130424 None None 588 None 13
ENSDART00000130957 None None 264 None 7
ENSDART00000131856 None None 246 None 10
ENSDART00000131870 None None 649 None 13
ENSDART00000133065 None None 227 None 7
ENSDART00000136863 None 252 251 8 8
ENSDART00000137220 None None 247 None 8
ENSDART00000139218 None None 243 None 8
ENSDART00000147348 None None 244 None 8
Genomic Location:
Chromosome 13 (position 22663210)
KASP Assay ID:
554-1373.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTTATTGCAGTGCAAGACCCTGATGAGGAAGCTCTGAGAAAGTCAAG[G/A]TAGGCATCCAGCAGCAGCATCTGGTGGCCACATATTTGAGTGGTGCKGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d7ul6lo9