ldb3a

Ensembl ID:
ENSDARG00000056322
ZFIN ID:
ZDB-GENE-040121-6
Description:
LIM-domain binding factor 3 [Source:RefSeq peptide;Acc:NP_958913]
Human Orthologue:
LDB3
Human Description:
LIM domain binding 3 [Source:HGNC Symbol;Acc:15710]
Mouse Orthologue:
Ldb3
Mouse Description:
LIM domain binding 3 Gene [Source:MGI Symbol;Acc:MGI:1344412]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1447 Essential Splice Site F2 line generated During 2015

Mutation Details

Allele Name:
sa1447
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044719 Essential Splice Site 252 283 7 8
ENSDART00000074061   None 589 None 13
ENSDART00000074064   None 501 None 12
ENSDART00000078720   None 159 None 6
ENSDART00000078721 Essential Splice Site 268 299 6 7
ENSDART00000078740 Essential Splice Site 260 291 9 10
ENSDART00000078747   None 580 None 12
ENSDART00000078757   None 596 None 11
ENSDART00000078759   None 649 None 12
ENSDART00000126467   None 646 None 14
ENSDART00000129841   None 350 None 11
ENSDART00000130101   None 200 None 5
ENSDART00000130424   None 588 None 13
ENSDART00000130957   None 264 None 7
ENSDART00000131856   None 246 None 10
ENSDART00000131870   None 649 None 13
ENSDART00000133065   None 227 None 7
ENSDART00000136863   252 251 8 8
ENSDART00000137220   None 247 None 8
ENSDART00000139218   None 243 None 8
ENSDART00000147348   None 244 None 8
Genomic Location:
Chromosome 13 (position 22663210)
KASP Assay ID:
554-1373.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTTATTGCAGTGCAAGACCCTGATGAGGAAGCTCTGAGAAAGTCAAG[G/A]TAGGCATCCAGCAGCAGCATCTGGTGGCCACATATTTGAGTGGTGCKGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d7ul6lo9