ldb3a

Ensembl ID:
ENSDARG00000056322
ZFIN ID:
ZDB-GENE-040121-6
Description:
LIM-domain binding factor 3 [Source:RefSeq peptide;Acc:NP_958913]
Human Orthologue:
LDB3
Human Description:
LIM domain binding 3 [Source:HGNC Symbol;Acc:15710]
Mouse Orthologue:
Ldb3
Mouse Description:
LIM domain binding 3 Gene [Source:MGI Symbol;Acc:MGI:1344412]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35470 Nonsense Mutation detected in F1 DNA During 2016
sa42182 Nonsense Mutation detected in F1 DNA During 2016
sa42183 Nonsense Mutation detected in F1 DNA During 2016
sa1447 Essential Splice Site F2 line generated During 2016

Mutation Details

Allele Name:
sa35470
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044719   None 283 None 8
ENSDART00000074061   None 589 None 13
ENSDART00000074064   None 501 None 12
ENSDART00000078720   None 159 None 6
ENSDART00000078721 Nonsense 113 299 4 7
ENSDART00000078740   None 291 None 10
ENSDART00000078747   None 580 None 12
ENSDART00000078757 Nonsense 113 596 4 11
ENSDART00000078759 Nonsense 113 649 4 12
ENSDART00000126467 Nonsense 113 646 4 14
ENSDART00000129841 Nonsense 113 350 4 11
ENSDART00000130101 Nonsense 113 200 5 5
ENSDART00000130424   None 588 None 13
ENSDART00000130957   None 264 None 7
ENSDART00000131856   None 246 None 10
ENSDART00000131870 Nonsense 113 649 5 13
ENSDART00000133065   None 227 None 7
ENSDART00000136863   None 251 None 8
ENSDART00000137220   None 247 None 8
ENSDART00000139218   None 243 None 8
ENSDART00000147348   None 244 None 8
Genomic Location:
Chromosome 13 (position 22653576)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACTTTTCTCCACACACACATACACCTCTTTTTTAAGGATCATCCTGTG[C/T]AAATAAATGGGGCTCTCTCATCTTCTGCTGAGACAAACTCATGCAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42182
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044719   None 283 None 8
ENSDART00000074061   None 589 None 13
ENSDART00000074064   None 501 None 12
ENSDART00000078720 Nonsense 132 159 5 6
ENSDART00000078721   None 299 None 7
ENSDART00000078740   None 291 None 10
ENSDART00000078747   None 580 None 12
ENSDART00000078757   None 596 None 11
ENSDART00000078759   None 649 None 12
ENSDART00000126467   None 646 None 14
ENSDART00000129841   None 350 None 11
ENSDART00000130101   None 200 None 5
ENSDART00000130424   None 588 None 13
ENSDART00000130957   None 264 None 7
ENSDART00000131856   None 246 None 10
ENSDART00000131870   None 649 None 13
ENSDART00000133065   None 227 None 7
ENSDART00000136863   None 251 None 8
ENSDART00000137220   None 247 None 8
ENSDART00000139218   None 243 None 8
ENSDART00000147348   None 244 None 8
Genomic Location:
Chromosome 13 (position 22657795)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTAGTAACAGCCTCCTGGCATAGCATTGTAGTGCTCTGTGTGGTATA[C/A]ATGCATGGAATTGTTTGGAACTGCCTTTGTGGTGTCTTATCAACAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044719 Nonsense 238 283 6 8
ENSDART00000074061   None 589 None 13
ENSDART00000074064   None 501 None 12
ENSDART00000078720   None 159 6 6
ENSDART00000078721 Nonsense 254 299 5 7
ENSDART00000078740 Nonsense 246 291 8 10
ENSDART00000078747   None 580 None 12
ENSDART00000078757   None 596 None 11
ENSDART00000078759   None 649 None 12
ENSDART00000126467   None 646 None 14
ENSDART00000129841   None 350 None 11
ENSDART00000130101   None 200 None 5
ENSDART00000130424   None 588 None 13
ENSDART00000130957   None 264 None 7
ENSDART00000131856   None 246 None 10
ENSDART00000131870   None 649 None 13
ENSDART00000133065   None 227 None 7
ENSDART00000136863 Nonsense 238 251 7 8
ENSDART00000137220 Nonsense 246 247 8 8
ENSDART00000139218   None 243 None 8
ENSDART00000147348   None 244 None 8
Genomic Location:
Chromosome 13 (position 22663073)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGCTGCAGTCCAAGTCCTTCCGCGTCCTCGCCCACATTACTGGAACT[G/T]AATACAGTGAGTCTGACTGTCAATTTCTTTTAGCTTGATGTTGATTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1447
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044719 Essential Splice Site 252 283 7 8
ENSDART00000074061   None 589 None 13
ENSDART00000074064   None 501 None 12
ENSDART00000078720   None 159 None 6
ENSDART00000078721 Essential Splice Site 268 299 6 7
ENSDART00000078740 Essential Splice Site 260 291 9 10
ENSDART00000078747   None 580 None 12
ENSDART00000078757   None 596 None 11
ENSDART00000078759   None 649 None 12
ENSDART00000126467   None 646 None 14
ENSDART00000129841   None 350 None 11
ENSDART00000130101   None 200 None 5
ENSDART00000130424   None 588 None 13
ENSDART00000130957   None 264 None 7
ENSDART00000131856   None 246 None 10
ENSDART00000131870   None 649 None 13
ENSDART00000133065   None 227 None 7
ENSDART00000136863   252 251 8 8
ENSDART00000137220   None 247 None 8
ENSDART00000139218   None 243 None 8
ENSDART00000147348   None 244 None 8
Genomic Location:
Chromosome 13 (position 22663210)
KASP Assay ID:
554-1373.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTTATTGCAGTGCAAGACCCTGATGAGGAAGCTCTGAGAAAGTCAAG[G/A]TAGGCATCCAGCAGCAGCATCTGGTGGCCACATATTTGAGTGGTGCKGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link