a2ml

Ensembl ID:
ENSDARG00000056314
ZFIN ID:
ZDB-GENE-090212-1
Description:
alpha-2-macroglobulin-like [Source:RefSeq peptide;Acc:NP_001132951]
Human Orthologue:
A2ML1
Human Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12900 Nonsense Available for shipment Available now
sa10524 Essential Splice Site Available for shipment Available now
sa6372 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078734 Nonsense 227 1442 7 34
Genomic Location:
Chromosome 15 (position 20086454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAGTTATTGTAATACTAACTGTCTTGATTTCTAGTTTTGCCTAAGTTT[G/T]AAGTTACRGTAAAAAAACCAAAGAYAGTGAGTGTWGTTGMGGAGGAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10524
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078734 Essential Splice Site 498 1442 13 34
Genomic Location:
Chromosome 15 (position 20085053)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTTTNTTCTTTGCAATTTTGTTTATCAGAGTGTCGTCTGTCTGTTTC[A/T]GGTCTTGTCCAGAGGAGTRATYGTTCATCATGGATTTGAGAAGGTTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078734 Nonsense 1406 1442 33 34
Genomic Location:
Chromosome 15 (position 20076031)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCYMTAAAAATGTTGCAATGAATTACCAGATACAAATGAARCAGGTTCTA[C/T]AAGTTAAGAATCTYAAGCCAGCTGTGGTCAAAGTGTATGATTACTACCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6zunjtpl