a2ml

Ensembl ID:
ENSDARG00000056314
ZFIN ID:
ZDB-GENE-090212-1
Description:
alpha-2-macroglobulin-like [Source:RefSeq peptide;Acc:NP_001132951]
Human Orthologue:
A2ML1
Human Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12900 Nonsense Available for shipment Available now
sa10524 Essential Splice Site Available for shipment Available now
sa6372 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078734 Nonsense 227 1442 7 34
Genomic Location (Zv9):
Chromosome 15 (position 20086454)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21189080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAGTTATTGTAATACTAACTGTCTTGATTTCTAGTTTTGCCTAAGTTT[G/T]AAGTTACRGTAAAAAAACCAAAGAYAGTGAGTGTWGTTGMGGAGGAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10524
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078734 Essential Splice Site 498 1442 13 34
Genomic Location (Zv9):
Chromosome 15 (position 20085053)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21187679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTTTNTTCTTTGCAATTTTGTTTATCAGAGTGTCGTCTGTCTGTTTC[A/T]GGTCTTGTCCAGAGGAGTRATYGTTCATCATGGATTTGAGAAGGTTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078734 Nonsense 1406 1442 33 34
Genomic Location (Zv9):
Chromosome 15 (position 20076031)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21178657
KASP Assay ID:
554-4677.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCYMTAAAAATGTTGCAATGAATTACCAGATACAAATGAARCAGGTTCTA[C/T]AAGTTAAGAATCTYAAGCCAGCTGTGGTCAAAGTGTATGATTACTACCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link