dixdc1b

Ensembl ID:
ENSDARG00000056267
ZFIN ID:
ZDB-GENE-041008-148
Human Orthologue:
DIXDC1
Human Description:
DIX domain containing 1 [Source:HGNC Symbol;Acc:23695]
Mouse Orthologue:
Dixdc1
Mouse Description:
DIX domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2679721]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37312 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078651 Essential Splice Site 55 677 2 21
Genomic Location (Zv9):
Chromosome 21 (position 24358285)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25043959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGATCTCAGAGACGGTGTGGTACTAGCACACCTCATTGAGATAGTGGG[T/G]AAGTCTCTTCTTATTGTACCACAGTTCTAGGGTGGCACGGAGGCTTAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link