tmem131

Ensembl ID:
ENSDARG00000056259
Human Orthologue:
TMEM131
Human Description:
transmembrane protein 131 [Source:HGNC Symbol;Acc:30366]
Mouse Orthologue:
Tmem131
Mouse Description:
transmembrane protein 131 Gene [Source:MGI Symbol;Acc:MGI:1927110]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17150 Nonsense Available for shipment Available now
sa44637 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14723 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17150
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078665 Nonsense 322 1799 11 41
Genomic Location (Zv9):
Chromosome 6 (position 29060989)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29356632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
MAATTYTCTGCRTCCTTTTAAWTTTACAGATCGACCAAAACAACTRAATT[T/A]GCATCTGTTAAATTCAGGAGCAAAAGATGTRTCRATCATGGTAAGTTGWA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44637
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078665 Essential Splice Site 553 1799 16 41
Genomic Location (Zv9):
Chromosome 6 (position 29056755)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACACCAGCAGTTTGGTGTTTGTTGTGGTCAACAGCAATCCAATTGAGG[T/C]ACAAGGTCATCACTTTCAGTACATTGTGTGACGTGATGTTTGGATAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078665 Essential Splice Site 861 1799 24 41
Genomic Location (Zv9):
Chromosome 6 (position 29049186)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29344829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTTTATACCCCAATCCCTCAGTGTKCACWGGCAAACTTGCTGACAGG[T/G]AAGATTTCCCACTTTCTTTCAGRAATGTTATAGCWTATRGTTTTTAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link