cdc27

Ensembl ID:
ENSDARG00000056258
ZFIN ID:
ZDB-GENE-990706-2
Description:
cell division cycle protein 27 homolog [Source:RefSeq peptide;Acc:NP_958857]
Human Orthologue:
CDC27
Human Description:
cell division cycle 27 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:1728]
Mouse Orthologue:
Cdc27
Mouse Description:
cell division cycle 27 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:102685]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19990 Nonsense Mutation detected in F1 DNA During 2016
sa33150 Nonsense Mutation detected in F1 DNA During 2016
sa6033 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078707 Nonsense 120 790 4 19
ENSDART00000132190 Nonsense 120 833 4 19
ENSDART00000147721   None 67 None 3

The following transcripts of ENSDARG00000056258 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 22252950)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21909341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGACATCATAACTGAGTTTGGAGACTCGGCCTGCTTCACTCTGGCAT[T/A]GCTCGGACAAATTTACTGGTATGTTGAGCTTGTTTGGCTTCTAAACTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33150
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078707   None 790 None 19
ENSDART00000132190 Nonsense 484 833 12 19
ENSDART00000147721   None 67 None 3

The following transcripts of ENSDARG00000056258 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 22262801)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21919192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACCCTGATGCGGGATATTGGGAGGGGATATCTTGCTCTCTGCTCTTA[T/A]AACTGCCGAGAGGCCATTAACATCTTGAGTCAGCTACCTTCACACCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078707 Nonsense 768 790 19 19
ENSDART00000132190 Nonsense 811 833 19 19
ENSDART00000147721   None 67 None 3

The following transcripts of ENSDARG00000056258 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 22267333)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21923724
KASP Assay ID:
554-3813.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTCGGTGTAATGCTGTTTGTTGGTCTCTGCAGCGGAGGTGGAGGAAT[C/A]ACAGGAGAGCAGTATGACGGACGCTGACGACACTCAGCTCCACACGACGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link