add3b

Ensembl ID:
ENSDARG00000056250
ZFIN IDs:
ZDB-GENE-080718-6, ZDB-GENE-080718-6
Description:
Add3b protein [Source:UniProtKB/TrEMBL;Acc:B1WB82]
Human Orthologue:
ADD3
Human Description:
adducin 3 (gamma) [Source:HGNC Symbol;Acc:245]
Mouse Orthologue:
Add3
Mouse Description:
adducin 3 (gamma) Gene [Source:MGI Symbol;Acc:MGI:1351615]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23045 Essential Splice Site Available for shipment Available now
sa28836 Nonsense Mutation detected in F1 DNA During 2015
sa10508 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078703 Essential Splice Site 294 706 7 15
ENSDART00000126577 Essential Splice Site 294 722 6 14
Genomic Location:
Chromosome 17 (position 20089768)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAGCAGGAGAAGATGGAGCTTCAGAAAGCTTTGGGTCCCACTGCCAAG[G/A]TGACAGCTAACCGTTGGCATGACAACTATTAGTAGTTTACTGTATAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078703 Nonsense 298 706 8 15
ENSDART00000126577 Nonsense 298 722 7 14
Genomic Location:
Chromosome 17 (position 20089507)
KASP Assay ID:
2261-0896.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGATTTACAACAGTAATGCAATTCTGCTTGTTTGTAGGTTTTAGTCT[T/A]GAGGAATCAAGGTTTACTGGCGTTTGGAGAGACGATAGAGGAAGCTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078703 Nonsense 381 706 9 15
ENSDART00000126577 Nonsense 381 722 8 14
Genomic Location:
Chromosome 17 (position 20087018)
KASP Assay ID:
2261-0895.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCAGATGGAGGRTTGGAGARGCAGAATTTGAGTCGCTTATGAGGATGT[T/A]AGATAAYTTAGTGAGTGGGTTTTAARAGAATTTCTACCAGAYGTGYGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Biliary atresia: Genome-wide association study identifies a susceptibility locus for biliary atresia on 10q24.2. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ytmeymf7