add3b

Ensembl ID:
ENSDARG00000056250
ZFIN IDs:
ZDB-GENE-080718-6, ZDB-GENE-080718-6
Description:
Add3b protein [Source:UniProtKB/TrEMBL;Acc:B1WB82]
Human Orthologue:
ADD3
Human Description:
adducin 3 (gamma) [Source:HGNC Symbol;Acc:245]
Mouse Orthologue:
Add3
Mouse Description:
adducin 3 (gamma) Gene [Source:MGI Symbol;Acc:MGI:1351615]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23045 Essential Splice Site Available for shipment Available now
sa10508 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078703 Essential Splice Site 294 706 7 15
ENSDART00000126577 Essential Splice Site 294 722 6 14
Genomic Location:
Chromosome 17 (position 20089768)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAGCAGGAGAAGATGGAGCTTCAGAAAGCTTTGGGTCCCACTGCCAAG[G/A]TGACAGCTAACCGTTGGCATGACAACTATTAGTAGTTTACTGTATAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078703 Nonsense 381 706 9 15
ENSDART00000126577 Nonsense 381 722 8 14
Genomic Location:
Chromosome 17 (position 20087018)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCAGATGGAGGRTTGGAGARGCAGAATTTGAGTCGCTTATGAGGATGT[T/A]AGATAAYTTAGTGAGTGGGTTTTAARAGAATTTCTACCAGAYGTGYGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Biliary atresia: Genome-wide association study identifies a susceptibility locus for biliary atresia on 10q24.2. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ytmeymf7