im:7138263

Ensembl ID:
ENSDARG00000056247
ZFIN ID:
ZDB-GENE-050208-85
Description:
HG21B [Source:UniProtKB/TrEMBL;Acc:Q2MGT5]
Human Orthologue:
C16orf79
Human Description:
chromosome 16 open reading frame 79 [Source:HGNC Symbol;Acc:28309]
Mouse Orthologue:
9930021D14Rik
Mouse Description:
RIKEN cDNA 9930021D14 gene Gene [Source:MGI Symbol;Acc:MGI:2441766]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10119 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10119
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078172 Essential Splice Site 111 228 4 6
Genomic Location:
Chromosome 12 (position 19584037)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTYTTTTCCCCTATAAAGCTCAGTTACATTTTGATATCTGGCTTCCTC[A/T]GGGCTTGGTTTGCTATAAACCTGACAACCAGGACAGCTGCTTTCTTCGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o2i35kax