NP_001083043.1

Ensembl ID:
ENSDARG00000056245
Description:
hypothetical protein LOC555791 [Source:RefSeq peptide;Acc:NP_001083043]
Human Orthologues:
TESK1, TESK2
Human Descriptions:
testis-specific kinase 1 [Source:HGNC Symbol;Acc:11731]
testis-specific kinase 2 [Source:HGNC Symbol;Acc:11732]
Mouse Orthologues:
Tesk1, Tesk2
Mouse Descriptions:
testis specific protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1201675]
testis-specific kinase 2 Gene [Source:MGI Symbol;Acc:MGI:2385204]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10210 Nonsense Available for shipment Available now
sa14219 Nonsense Available for shipment Available now
sa16503 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10210
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078708 Nonsense 86 313 4 10
Genomic Location (Zv9):
Chromosome 5 (position 30175830)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27937789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGGTAGTAAAGAWATATAAGAATGATGTTGATCAGGACAGCATTGTA[C/T]GAGAAATCAGCCTGCTGCAGAAACTTTCACACCCCAACATYGTGAGGTAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14219
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078708 Nonsense 86 313 4 10
Genomic Location (Zv9):
Chromosome 5 (position 30175830)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27937789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGGTAGTAAAGAWATATAAGAATGATGTTGATCAGGACAGCATTGTA[C/T]GAGAAATCAGCCTGCTGCAGAAACTTTCACACCCCAACATYGTGAGGTAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078708 Nonsense 296 313 10 10
Genomic Location (Zv9):
Chromosome 5 (position 30164724)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27926686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCTCGACGCWTTCAGAAGACCCTCGTTCACAGAGCTTCAAGATGAGT[T/A]GGGGGAGATTGCTGAGAGTTTGGAAAYTCCTCACTCTGAGCTCACCACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link