tmem45b

Ensembl ID:
ENSDARG00000056239
ZFIN ID:
ZDB-GENE-040426-1904
Description:
Transmembrane protein 45B [Source:UniProtKB/Swiss-Prot;Acc:Q6P0S3]
Human Orthologue:
TMEM45B
Human Description:
transmembrane protein 45B [Source:HGNC Symbol;Acc:25194]
Mouse Orthologue:
Tmem45b
Mouse Description:
transmembrane protein 45b Gene [Source:MGI Symbol;Acc:MGI:2384574]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23941 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23941
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112783 Nonsense 194 283 4 6
Genomic Location (Zv9):
Chromosome 21 (position 24520185)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25205859
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTGCTGGAGCTTTTGAGATGCACTCTGGCCATCCTACAAGGCACATG[G/A]TTCTACCAGGTAAAGACAACGGTGCAGACTCTTATGGGATTCAGGGTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link