pld1a

Ensembl ID:
ENSDARG00000056228
ZFIN ID:
ZDB-GENE-031002-2
Description:
phospholipase D1a [Source:RefSeq peptide;Acc:NP_001153567]
Human Orthologue:
PLD1
Human Description:
phospholipase D1, phosphatidylcholine-specific [Source:HGNC Symbol;Acc:9067]
Mouse Orthologue:
Pld1
Mouse Description:
phospholipase D1 Gene [Source:MGI Symbol;Acc:MGI:109585]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19763 Nonsense Available for shipment Available now
sa6842 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11536 Nonsense Available for shipment Available now
sa38333 Nonsense Mutation detected in F1 DNA During 2017
sa39837 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19763
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078686 Nonsense 56 1025 2 25
ENSDART00000133623 Nonsense 56 1022 3 26
Genomic Location (Zv9):
Chromosome 2 (position 25725967)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25922163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCCATCTACCGGACAGTTGGCTTTAAAGACACAGAAGCACATGTCTA[T/A]CTGACCTCTCTCCCAATTACTGCCAAGATCCTGGATGTGGAGCGCTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078686 Essential Splice Site 378 1025 11 25
ENSDART00000133623 Essential Splice Site 377 1022 12 26
Genomic Location (Zv9):
Chromosome 2 (position 25747166)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25943362
KASP Assay ID:
554-5154.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TKAGCAAGTCATGTCATAAAATATGCCATATGTTTGTGTTTGTAATGTGC[A/T]GGCTGAGCCCTGAGATCTTTCTGAAGAGGCCTGTGGTGGAAGGCAATCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11536
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078686 Nonsense 457 1025 13 25
ENSDART00000133623 Nonsense 456 1022 14 26
Genomic Location (Zv9):
Chromosome 2 (position 25749031)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25945227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACAGGTGATGAGACACCCTGATCACGTGTCCTCCTCCGTCTACTTATG[G/A]GCACATCAYGAAAAGATTGTAGTGATTGACCAGTCAGTTGCTTTTGTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078686 Nonsense 629 1025 16 25
ENSDART00000133623 Nonsense 626 1022 17 26
Genomic Location (Zv9):
Chromosome 2 (position 25755154)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25951350
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTGGTCTGTAGACTTTATCGACAGGTACACAACCCCTAGAATGCCCT[G/A]GCATGATATCTCCTCAGTGGTGCATGGAAAAGCAGCCAGAGATGTGGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078686 Nonsense 897 1025 23 25
ENSDART00000133623 Nonsense 894 1022 24 26
Genomic Location (Zv9):
Chromosome 2 (position 25776539)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25972735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTTGAGGACTCTGAAACCACGCCATCAGTGATGGACGGTCAAGAGTA[C/A]CAGGCCGGCAAGTTTGCCCTTCAGCTCAGACTGGAGTGCTTCAAGTAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link