creb3l3

Ensembl ID:
ENSDARG00000056226
ZFIN ID:
ZDB-GENE-030131-4298
Description:
Cyclic AMP-responsive element-binding protein 3-like protein 3-BProcessed cyclic AMP-responsive elem
Human Orthologue:
CREB3L3
Human Description:
cAMP responsive element binding protein 3-like 3 [Source:HGNC Symbol;Acc:18855]
Mouse Orthologue:
Creb3l3
Mouse Description:
cAMP responsive element binding protein 3-like 3 Gene [Source:MGI Symbol;Acc:MGI:2384786]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18218 Nonsense Available for shipment Available now
sa24151 Nonsense Mutation detected in F1 DNA During 2014
sa4173 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078683 Nonsense 33 428 2 10
ENSDART00000138688 Nonsense 65 460 2 10
Genomic Location:
Chromosome 22 (position 20444109)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGCTTTTTGACAAGAATGATGGCATCTTACGCTATGAGAATATGGGA[C/T]AACAGAACAATCAGCTTTGGCCAGTTCAAGATCCTMRTGTAAGTCAAYGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24151
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078683 Nonsense 134 428 4 10
ENSDART00000138688 Nonsense 166 460 4 10
Genomic Location:
Chromosome 22 (position 20440718)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTATTATCTGTGTCTGCAGATGGCTGGGAGACTGGTTTCCTCCCAGAT[C/T]AGTCCGGAGGGACGCAGTGTGCATCTGAAACGCCACAGGCACAACAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078683 Essential Splice Site 325 428 None 10
ENSDART00000138688 Essential Splice Site 357 460 None 10
Genomic Location:
Chromosome 22 (position 20432136)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRTCGTCACAAGTATTCTAAAGTGTCTTTGCTTTTTGTTTAACCTTTTGC[A/T]GTTCAGTCACGRTCACTGCACAACCTCCAGTCTTCCCGCGTCCTGCGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jgcjdlnc