creb3l3

Ensembl ID:
ENSDARG00000056226
ZFIN ID:
ZDB-GENE-030131-4298
Description:
Cyclic AMP-responsive element-binding protein 3-like protein 3-BProcessed cyclic AMP-responsive elem
Human Orthologue:
CREB3L3
Human Description:
cAMP responsive element binding protein 3-like 3 [Source:HGNC Symbol;Acc:18855]
Mouse Orthologue:
Creb3l3
Mouse Description:
cAMP responsive element binding protein 3-like 3 Gene [Source:MGI Symbol;Acc:MGI:2384786]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18218 Nonsense Available for shipment Available now
sa24151 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078683 Nonsense 33 428 2 10
ENSDART00000138688 Nonsense 65 460 2 10
Genomic Location (Zv9):
Chromosome 22 (position 20444109)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20100802
KASP Assay ID:
2261-6748.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGCTTTTTGACAAGAATGATGGCATCTTACGCTATGAGAATATGGGA[C/T]AACAGAACAATCAGCTTTGGCCAGTTCAAGATCCTMRTGTAAGTCAAYGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24151
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078683 Nonsense 134 428 4 10
ENSDART00000138688 Nonsense 166 460 4 10
Genomic Location (Zv9):
Chromosome 22 (position 20440718)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20097411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTATTATCTGTGTCTGCAGATGGCTGGGAGACTGGTTTCCTCCCAGAT[C/T]AGTCCGGAGGGACGCAGTGTGCATCTGAAACGCCACAGGCACAACAGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link