tnika

Ensembl ID:
ENSDARG00000056218
ZFIN ID:
ZDB-GENE-030131-3767
Description:
TRAF2 and NCK interacting kinase a [Source:RefSeq peptide;Acc:NP_955997]
Human Orthologue:
TNIK
Human Description:
TRAF2 and NCK interacting kinase [Source:HGNC Symbol;Acc:30765]
Mouse Orthologue:
Tnik
Mouse Description:
TRAF2 and NCK interacting kinase Gene [Source:MGI Symbol;Acc:MGI:1916264]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19764 Nonsense Available for shipment Available now
sa8613 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19764
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051234 Nonsense 373 1303 12 31
Genomic Location:
Chromosome 2 (position 25920230)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGCCTGCAGGTGGCCAATAAGGAGCGTTCAGACGCCCTGCGTAGACAA[C/T]AGCTTGAGCAGCAGCAGAACGAGGGACACAAACATCAACTGCTGGCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051234 Essential Splice Site 1177 1303 29 31
Genomic Location:
Chromosome 2 (position 25952592)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACTGGTCTCCTTTAGCACTGCAGCCTGTAACATCTTTTTTTCWTCCTT[A/T]GATTCAGAGCACTGTGACTCCTCATGCCATCGTGGTGCTTCCGAAGACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fz3zk6v9