tnika

Ensembl ID:
ENSDARG00000056218
ZFIN ID:
ZDB-GENE-030131-3767
Description:
TRAF2 and NCK interacting kinase a [Source:RefSeq peptide;Acc:NP_955997]
Human Orthologue:
TNIK
Human Description:
TRAF2 and NCK interacting kinase [Source:HGNC Symbol;Acc:30765]
Mouse Orthologue:
Tnik
Mouse Description:
TRAF2 and NCK interacting kinase Gene [Source:MGI Symbol;Acc:MGI:1916264]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32926 Nonsense Mutation detected in F1 DNA During 2016
sa19764 Nonsense Available for shipment Available now
sa25812 Nonsense Mutation detected in F1 DNA During 2016
sa39838 Nonsense Mutation detected in F1 DNA During 2016
sa8613 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32926
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051234 Nonsense 321 1303 11 31
Genomic Location (Zv9):
Chromosome 2 (position 25919983)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26116179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGAAATGTGACTGCTGAATGTTTTCACACCTACAGATGAGACGGAGTA[T/A]GAGTACAGCGGGAGTGAAGAGGAGGAAGAGGCCATGCTTGAGATTGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19764
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051234 Nonsense 373 1303 12 31
Genomic Location (Zv9):
Chromosome 2 (position 25920230)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26116426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGCCTGCAGGTGGCCAATAAGGAGCGTTCAGACGCCCTGCGTAGACAA[C/T]AGCTTGAGCAGCAGCAGAACGAGGGACACAAACATCAACTGCTGGCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051234 Nonsense 1064 1303 26 31
Genomic Location (Zv9):
Chromosome 2 (position 25946824)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26143020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGAAAAAAAATAAGCTCCGTGTGTACTACTTGTCATGGCTAAGAAAC[C/T]GAATACTGCACAATGACCCGGAGGTGGAGAAGAAGCAGGGCTGGATCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051234 Nonsense 1148 1303 28 31
Genomic Location (Zv9):
Chromosome 2 (position 25948999)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26145195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCACAGACCTCAGCTGGTGGACCTCACAGTAGAAGAGGGTCAGAGGT[T/G]AAAGGTCATCTACGGCTCTAGTGTGGGCTTTCACGTCATCGATGTGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051234 Essential Splice Site 1177 1303 29 31
Genomic Location (Zv9):
Chromosome 2 (position 25952592)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26148788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACTGGTCTCCTTTAGCACTGCAGCCTGTAACATCTTTTTTTCWTCCTT[A/T]GATTCAGAGCACTGTGACTCCTCATGCCATCGTGGTGCTTCCGAAGACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link